Free Republic
Browse · Search
General/Chat
Topics · Post Article

Skip to comments.

Was an Extinct Fox Once Man's Best Friend?
BBC ^ | 4/10 | Helen Briggs

Posted on 04/10/2024 1:33:12 PM PDT by nickcarraway

Our ancestors may have kept foxes as pets long before domestic dogs came on the scene.

Archaeological evidence suggests ancient human societies in South America revered foxes to such an extent that they were buried next to them.

Scientists were surprised to find a fox buried in a human grave dating back 1,500 years in Patagonia, Argentina.

They think the most likely explanation is that the fox was a highly valued companion or pet.

DNA analysis shows the animal dined with prehistoric hunter gatherers and was part of the inner circle of the camp.

A fox of the same species was found in a much older grave in another part of Argentina nearly a decade ago. It may also have been a pet but its diet was not analysed.

"This is a very rare find of having this fox that appears to have had such a close bond with individuals from the hunter-gatherer society," said Dr Ophélie Lebrasseur of the University of Oxford.

(Excerpt) Read more at bbc.com ...


TOPICS: History; Outdoors; Pets/Animals
KEYWORDS: animalhusbandry; archaeological; argentina; fox; godsgravesglyphs; southamerica; wildlife

1 posted on 04/10/2024 1:33:12 PM PDT by nickcarraway
[ Post Reply | Private Reply | View Replies]

To: nickcarraway

“I’m a Mox. Half-man, half-fox, I’m my own best friend.”


2 posted on 04/10/2024 1:34:32 PM PDT by dfwgator (Endut! Hoch Hech!)
[ Post Reply | Private Reply | To 1 | View Replies]

To: nickcarraway

The Festrunk brothers want to know more.


3 posted on 04/10/2024 1:36:46 PM PDT by posterchild
[ Post Reply | Private Reply | To 1 | View Replies]

To: dfwgator

4 posted on 04/10/2024 1:37:39 PM PDT by nickcarraway
[ Post Reply | Private Reply | To 2 | View Replies]

To: nickcarraway

Shouldn’t be a shocker: foxes are easier to tame than most wild animals. I had a bunch of pet foxes at the naval gunfire range off San Diego. Would feed them mess hall baloney by hand while we watched the ships fire.


5 posted on 04/10/2024 1:48:48 PM PDT by Chainmail (How do I feel about ignorance and apathy? I don't know and I don't care.)
[ Post Reply | Private Reply | To 1 | View Replies]

To: Chainmail

Do the get covered by the VA?


6 posted on 04/10/2024 1:53:58 PM PDT by nickcarraway
[ Post Reply | Private Reply | To 5 | View Replies]

To: nickcarraway

Probably more responsively than the rest of us...


7 posted on 04/10/2024 2:30:37 PM PDT by Chainmail (How do I feel about ignorance and apathy? I don't know and I don't care.)
[ Post Reply | Private Reply | To 6 | View Replies]

To: nickcarraway

I have had fox come into the yard and want to play like a dog. Having said that folks should be aware that fox can carry rabies. The arctic foxes on the north slope can get absolutely crazy when rabid.


8 posted on 04/10/2024 2:34:02 PM PDT by FrozenAssets (You don't have to be crazy to live here, but it helps)
[ Post Reply | Private Reply | To 1 | View Replies]

To: nickcarraway

The Senator’s Hall of Fame pitcher Walter Johnson kept one as a pet, until a neighbor (accidentally) shot it.


9 posted on 04/10/2024 2:37:39 PM PDT by Boiler Plate ("Why be difficult, when with just a little more work, you can be impossible" Mom)
[ Post Reply | Private Reply | To 1 | View Replies]

To: nickcarraway

There is credibility to that speculation; keeping foxes as pets. Looking back, there is a famous painting showing a woman cuddling an ermine, sometimes called a ferret.

See Leonardo Da Vinci’s “Lady with an Ermine” painted about 1489.
Cecilla Gallerani tenderly holds her pet.

Some say this work is ‘better than’ Da Vinci’s later work called The Mona Lisa. Both show elegant, though unreadable young women.


10 posted on 04/10/2024 2:56:08 PM PDT by lee martell
[ Post Reply | Private Reply | To 1 | View Replies]

To: Chainmail
There was a guy in Russia who spent decades breeding foxes into pets.

At some point his funding stopped so I don't know if he succeeded in achieving his goal.

I imagine he at least got as far as breeding foxes who were less dangerous than pit bulls.

11 posted on 04/10/2024 4:22:08 PM PDT by who_would_fardels_bear (Kafka was an optimist.)
[ Post Reply | Private Reply | To 5 | View Replies]

To: nickcarraway

12 posted on 04/10/2024 4:54:04 PM PDT by mikey_hates_everything
[ Post Reply | Private Reply | To 4 | View Replies]

To: StayAt HomeMother; Ernest_at_the_Beach; 1ofmanyfree; 21twelve; 24Karet; 2ndDivisionVet; 31R1O; ...
It went extinct because the last one was eaten by Chupacabra!!! ;^)

13 posted on 04/10/2024 10:05:04 PM PDT by SunkenCiv (Putin should skip ahead to where he kills himself in the bunker.)
[ Post Reply | Private Reply | View Replies]

To: SunkenCiv

Over the years, I’ve hand fed quite a few foxes at my place in NC.


14 posted on 04/11/2024 12:42:13 AM PDT by ComputerGuy (Heavily-medicated for your protection)
[ Post Reply | Private Reply | To 13 | View Replies]

To: who_would_fardels_bear; SunkenCiv

I also read about people in Russia taming foxes. I believe they said it took 8 generations of breeding the tamest ofspring to end up with a tame fox. I think they also tried breeding in the more wild direction with success.


15 posted on 04/11/2024 3:07:53 AM PDT by gleeaikin ( Question authority.)
[ Post Reply | Private Reply | To 11 | View Replies]

To: gleeaikin

https://search.brave.com/search?q=soviet+era+breeding+programs


16 posted on 04/11/2024 3:11:30 AM PDT by SunkenCiv (Putin should skip ahead to where he kills himself in the bunker.)
[ Post Reply | Private Reply | To 15 | View Replies]

To: SunkenCiv
It went extinct because the last one was eaten by Chupacabra!!! ;^)

.. and here is the proof https://grimm.fandom.com/wiki/Chupacabra

17 posted on 04/11/2024 4:34:43 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 13 | View Replies]

To: mikey_hates_everything

What movie was that from?


18 posted on 04/12/2024 7:04:19 AM PDT by JoeRender
[ Post Reply | Private Reply | To 12 | View Replies]

To: JoeRender

1978 version of Invasion of the Body Snatchers.


19 posted on 04/12/2024 12:28:00 PM PDT by mikey_hates_everything
[ Post Reply | Private Reply | To 18 | View Replies]

Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.

Free Republic
Browse · Search
General/Chat
Topics · Post Article

FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson