Free Republic
Browse · Search
General/Chat
Topics · Post Article

Skip to comments.

'We made a big mistake’ — COVID Vaccine spike protein travels from injection site, can cause organ damage
nationaldailyng ^ | June 6, 2021 | Megan Redshaw

Posted on 08/11/2021 10:48:11 PM PDT by RandFan

COVID vaccine researchers had previously assumed mRNA COVID vaccines would behave like traditional vaccines. The vaccine’s spike protein — responsible for infection and its most severe symptoms — would remain mostly in the injection site at the shoulder muscle or local lymph nodes.

But new research obtained by a group of scientists contradicts that theory, a Canadian cancer vaccine researcher said last week.

“We made a big mistake. We didn’t realize it until now,” said Byram Bridle, a viral immunologist and associate professor at University of Guelph, Ontario. “We thought the spike protein was a great target antigen, we never knew the spike protein itself was a toxin and was a pathogenic protein. So by vaccinating people we are inadvertently inoculating them with a toxin.”

(Excerpt) Read more at nationaldailyng.com ...


TOPICS: Conspiracy
KEYWORDS: adspam; allvaxedsheep; biodistribution; clickbait; covid1984; doomscrolling; fearporn; getagrip; hysteria; protein; vaccine; zotthekeywordtroll
Navigation: use the links below to view more comments.
first previous 1-20 ... 41-6061-8081-100101-106 next last
To: DEPcom

For the people who do not trust the spike protein vaccine, there are new vaccines on the way. Hang in there, they are aware of the issues.


Why vaccinate for something that’s 99.9% survivable??

That is mistake #1.

And, you do NOT vaccinate out of a PlanDEMIc. You treat, with safe, effective, LONG USED and approved drugs.

Enough of BigPharma profiting off of this.


81 posted on 08/12/2021 6:50:55 AM PDT by Jane Long (America, Bless God....blessed be the Nation.)
[ Post Reply | Private Reply | To 71 | View Replies]

To: Jane Long

“99.9% survivable”

Do you have a source for that? I have been looking and not able to find a source that breaks it out by age.


82 posted on 08/12/2021 7:18:54 AM PDT by DEPcom (I create the code behind buttons Admin click to execute commands on servers and sql servers.)
[ Post Reply | Private Reply | To 81 | View Replies]

To: DEPcom

The numbers have been posted numerous times, by age groups and average.

Thread after thread.

The next time I see them (sources, etc), I’ll try to remember to ping you.


83 posted on 08/12/2021 7:28:11 AM PDT by Jane Long (America, Bless God....blessed be the Nation.)
[ Post Reply | Private Reply | To 82 | View Replies]

To: Tolerance Sucks Rocks; null and void; ExTexasRedhead
(From the article):" Bridle,.. said he and a group of international scientists filed a request
for information from the Japanese regulatory agency to get access to Pfizer’s “biodistribution study.
Biodistribution studies are used to determine where an injected compound travels in the body, and which tissues or organs it accumulates in."

That distribution information is already immediately available in a forensic autopsy of anyone who died after taking 'the jab'.
The information is there,.. but you have to be looking for it
in order to find it !

84 posted on 08/12/2021 8:17:51 AM PDT by Tilted Irish Kilt
[ Post Reply | Private Reply | To 43 | View Replies]

To: Jane Long

thanks


85 posted on 08/12/2021 8:51:05 AM PDT by DEPcom (I create the code behind buttons Admin click to execute commands on servers and sql servers.)
[ Post Reply | Private Reply | To 83 | View Replies]

To: AdmSmith

pong


86 posted on 08/12/2021 11:06:58 AM PDT by nuconvert ( Warning: Accused of being a radical militarist. Approach with caution.)
[ Post Reply | Private Reply | To 2 | View Replies]

To: RandFan

Lowell “The Hammer” Stanley in 3,2,1..


87 posted on 08/12/2021 11:09:51 AM PDT by smvoice (I WILL NOT WEAR THE RIBBON. OR THE MASK)
[ Post Reply | Private Reply | To 1 | View Replies]

To: napscoordinator

Yes, we all pass, sooner or later. My salvation cannot be taken away, and “we will do more than the Christ has done”. I trust in the Lord, not man.


88 posted on 08/12/2021 11:25:36 AM PDT by exnavy (grow some thick skin, i do not care for whiners)
[ Post Reply | Private Reply | To 39 | View Replies]

To: exnavy

Yes but don’t forget that suicide is a mortal sin. You better hope that God doesn’t mind you causing a natural death. You could be in a beep of trouble.


89 posted on 08/12/2021 11:27:30 AM PDT by napscoordinator (Trump/Hunter, jr for President/Vice President 2016 )
[ Post Reply | Private Reply | To 88 | View Replies]

To: nuconvert

Megan Redshaw is a freelance reporter for The Defender. She has a background in political science, a law degree and extensive training in natural health.

LOL!


90 posted on 08/12/2021 12:24:44 PM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 86 | View Replies]

To: SoConPubbie

“... the fact that historically, only 1% to 5% of actual adverse events get reported to the Voluntary VAERS system”

Yep. That’s a huge concern for me especially when there are so many people making a huge profit and need the adverse events reports to go away.


91 posted on 08/12/2021 2:19:28 PM PDT by SouthernClaire (God Bless America)
[ Post Reply | Private Reply | To 33 | View Replies]

To: jonrick46

I estimated a couple of weeks ago that there were over 6 times as many adverse events for Covid vaccines as for the other vaccines per dose. If that estimate were accurate, would that make you wonder about the safety of the Covid vaccines?

I read about 120 of the actual reports. While it’s possible someone is trying to make these vaccines look bad, I doubt it.The reports were more substantial than my cousin’s lawyer’s gardener had some vaccine and died six months later because of the Trump/Biden vaccine. Note that my very small sample didn’t have any reports of vaccine at 1, died at 2, either.


92 posted on 08/12/2021 3:19:46 PM PDT by Tymesup
[ Post Reply | Private Reply | To 35 | View Replies]

To: RandFan

The ‘researchers’ knew what would happen with the popisson since it killed all their research animals before being tested on human populations. The great lie continues ...


93 posted on 08/12/2021 3:42:01 PM PDT by MHGinTN (A dispensation perspective is a powerful tool for discernment)
[ Post Reply | Private Reply | To 1 | View Replies]

To: NoLibZone

Read up on the Rapture of the Body of Christ Believers. We be outta here, soon ...


94 posted on 08/12/2021 3:59:39 PM PDT by MHGinTN (A dispensation perspective is a powerful tool for discernment)
[ Post Reply | Private Reply | To 5 | View Replies]

To: Secret Agent Man

I know nothing about vaccines, but assuming the vaccine does not travel throughout the body sounds incredibly stupid.


95 posted on 08/12/2021 5:36:56 PM PDT by NetAddicted ( Just looking)
[ Post Reply | Private Reply | To 8 | View Replies]

To: jonrick46

The spike protein causes the clotting. They are shooting the spike proteins into the deltoid muscle and it only stays in that muscle a short time. Then it moves to other organs in the body.
Don’t use the words “experts”. Nobody knows what will happen with these fake vaxes. RATs use this word “debunked” as though the outcome that their “experts” decide on is the only correct opinion.


96 posted on 08/12/2021 5:46:41 PM PDT by dforest (huh)
[ Post Reply | Private Reply | To 11 | View Replies]

To: dforest

That spike protein is enveloped by the lipid nanoparticle. The immune system swallows it up, spike protein and all. Who says the spike protein is floating around in the circulatory system?


97 posted on 08/12/2021 5:50:45 PM PDT by jonrick46 (Leftnicks chase illusions of motherships at the end of the pier.)
[ Post Reply | Private Reply | To 96 | View Replies]

To: jonrick46

See post #84.


98 posted on 08/12/2021 6:01:22 PM PDT by dforest (huh)
[ Post Reply | Private Reply | To 97 | View Replies]

To: napscoordinator

What?


99 posted on 08/13/2021 2:17:48 PM PDT by exnavy (grow some thick skin, i do not care for whiners)
[ Post Reply | Private Reply | To 89 | View Replies]

To: RandFan

Ping - debate on shot morbidity


100 posted on 08/13/2021 4:39:04 PM PDT by WhattheDickens? (Funny, I didn’t think this was 1984…)
[ Post Reply | Private Reply | To 1 | View Replies]


Navigation: use the links below to view more comments.
first previous 1-20 ... 41-6061-8081-100101-106 next last

Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.

Free Republic
Browse · Search
General/Chat
Topics · Post Article

FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson