Free Republic
Browse · Search
General/Chat
Topics · Post Article

Skip to comments.

Kazakhstan to change from Cyrillic to Latin alphabet
Deutsche Welle ^ | 10.27.2017 | cw/sms (AFP, dpa, Reuters)

Posted on 10/27/2017 9:34:09 PM PDT by Olog-hai

Kazakhstan’s President Nursultan Nazarbayev on Friday announced the country’s alphabet will gradually switch from Cyrillic to Latin script.

Kazakh, a Turkic language, currently uses a modified Cyrillic alphabet with 42 letters.

The Latin alphabet will have 32 letters. Certain sounds will be covered by the use of apostrophes. The changeover is scheduled to be fully implemented by 2025.

Officials said the switch is part of a modernization drive and an attempt to make use of technology easier. The Kazakh Cyrillic keyboard, for example, uses all number and punctuation keys in order to cover the 42 letters of Cyrillic alphabet.

The Foreign Ministry said in September that the switch to Latin script would also benefit Kazakhstan’s development. “[Latin] is used by approximately 70 percent of all countries, making it an essential part of communicating across the globe, especially in terms of technology, business, science and education,” the ministry said.

The oil-rich republic is a close ally of Russia and has the largest ethnic-Russian population of the former Soviet republics in Central Asia. Russian will remain an official language.…

(Excerpt) Read more at dw.com ...


TOPICS: Books/Literature; Education; Local News; Society
KEYWORDS: cyrillicalphabet; kazakhstan; latinalphabet; russia

1 posted on 10/27/2017 9:34:09 PM PDT by Olog-hai
[ Post Reply | Private Reply | View Replies]

To: Olog-hai

That’s a tiugh row to hoe.

At least they don’t have to switch directions too.


2 posted on 10/27/2017 9:40:46 PM PDT by Paladin2 (No spelchk nor wrong word auto substition on mobile dev. Please be intelligent and deal with it....)
[ Post Reply | Private Reply | To 1 | View Replies]

To: Paladin2

Looks like Putin has some more ethnic Russians to “protect.” Nazarbayev best tip toe through the tulips on this one.


3 posted on 10/27/2017 9:53:09 PM PDT by lodi90
[ Post Reply | Private Reply | To 2 | View Replies]

To: Paladin2

Yeah, I don’t see how you can make this work.


4 posted on 10/27/2017 9:55:45 PM PDT by rdl6989
[ Post Reply | Private Reply | To 2 | View Replies]

To: rdl6989

That’s a third time in a century. They’ve started with Arabic script. Overall I think half of Kazakhs don’t even know their language and like nine in ten people are using Russian instead.
The same is true about most of the other stans which are artifical collections of tribes using Russian to understand each other.


5 posted on 10/27/2017 10:10:31 PM PDT by NorseViking
[ Post Reply | Private Reply | To 4 | View Replies]

To: Olog-hai

6 posted on 10/27/2017 10:11:52 PM PDT by Slyfox (Are you tired of winning yet?)
[ Post Reply | Private Reply | To 1 | View Replies]

To: rdl6989

“Yeah, I don’t see how you can make this work.”

Turkey did (Arabic script to Latin alphabet).

Mongolia went from Hudum Mongol bichig to Cyrillic. And that was after TWICE adopting the Latin alphabet: https://en.wikipedia.org/wiki/Mongolian_Latin_alphabet

On Kazakhstan’s part, however, this is a mistake because 1) Everyone there is already familiar with the Cyrillic alphabet and 2) this will alienate its substantial Russian population. Russians and Ukrainians are 25% of the population.


7 posted on 10/27/2017 10:15:55 PM PDT by vladimir998 (Apparently I'm still living in your head rent free. At least now it isn't empty.)
[ Post Reply | Private Reply | To 4 | View Replies]

To: Paladin2

It won’t be nearly as tough as Turkey’s 20th century complete replacement of its Persian-Arabic based alphabet with a Latin-based “Western” alphabet.


8 posted on 10/27/2017 10:16:24 PM PDT by House Atreides (BOYCOTT the NFL, its products and players 100% - PERMANENTLY.)
[ Post Reply | Private Reply | To 2 | View Replies]

To: lodi90

In the long term, Russia will annex at least part of Kazakhstan.


9 posted on 10/27/2017 10:17:20 PM PDT by WatchungEagle
[ Post Reply | Private Reply | To 3 | View Replies]

To: House Atreides

Does Erdogen hope to reverse that?


10 posted on 10/27/2017 10:21:05 PM PDT by Paladin2 (No spelchk nor wrong word auto substition on mobile dev. Please be intelligent and deal with it....)
[ Post Reply | Private Reply | To 8 | View Replies]

Hell yeah, ANSI rules!!!


11 posted on 10/27/2017 10:31:53 PM PDT by Gene Eric (Don't be a statist!)
[ Post Reply | Private Reply | To 1 | View Replies]

To: WatchungEagle

https://m.youtube.com/watch?v=yt5GrfUknKs
Slums of Alma-Aty song from earlier 1990s. Slavics and Germans in Kazakhstan inner cities are thinking should they take a flight to Russia or revolt against discrimination by their muslim overlord. LOL.


12 posted on 10/27/2017 10:41:37 PM PDT by NorseViking
[ Post Reply | Private Reply | To 9 | View Replies]

To: vladimir998; NorseViking

Thanks, I learn something new every day.


13 posted on 10/27/2017 10:54:14 PM PDT by rdl6989
[ Post Reply | Private Reply | To 7 | View Replies]

To: Olog-hai
One of the most annoying consequences of political correctness in literature is the use of Cyrillic whenever Russian words are included in a text. So no more nyet or dos vedanya. Instead we see an indecipherable sequence of characters known only to those who studied Russian.

There are so many cool Russian words that people are missing out on because their latinized versions are no longer included.

Absolutely stupid and useless and tending toward separating people rather than bringing them together.

14 posted on 10/27/2017 11:09:41 PM PDT by who_would_fardels_bear
[ Post Reply | Private Reply | To 1 | View Replies]

To: Olog-hai
The Foreign Ministry said in September that the switch to Latin script would also benefit Kazakhstan’s development.

Gee, I suggested this here about two weeks ago, but to bring Russia closer to the West.

15 posted on 10/28/2017 3:48:51 AM PDT by Does so (McAuliffe's Charlottesville...and...The Walter Duranty Press"...)
[ Post Reply | Private Reply | To 1 | View Replies]

To: Olog-hai

Kazakhstan has the coolest sport ever: Kokpar.

Here’s an example from the 2017 world championships: Usa vs. Mongolia. I didn’t even know the USA had a Kokpar team. It’s safe to watch as nobody takes a knee for the anthem.

https://youtu.be/4Ill3YJtOhw


16 posted on 10/28/2017 4:04:23 AM PDT by j. earl carter
[ Post Reply | Private Reply | To 1 | View Replies]

To: All
Speaking of Kazahk president Nazarbayev, here's a little tidbit of interest.

This gambit by Bill Clinton (meddling in a foreign election) got the Russian uranium scheme going. Bill's calculated handshake was a bonanza for the Kazahk president's re-election. Nazarbayev responded in kind and signed-off on the initial phase of Russia's takeover of US uranium assets.

Kazakh President Nursultan Nazarbayev greets former
president Clinton (L) in Almaty on September 6, 2005.

CIRCA 2015 A Pulitzer Prize-winning New York Times reporter claims that former President Bill Clinton falsely denied hosting a meeting with Kazakh officials when she tried to write a story that involved his foundation several years ago.

Jo Becker, who works on the newspaper's investigative desk, said Clinton only confirmed the meeting took place after she informed him there were photographs.

Clinton's role in a deal that involved Kazakhstan, the Russian government, and a man who donated millions to the president's charitable foundation were detailed in a story Becker published on Thursday.

That article revisited some of her earlier reporting and included information from the upcoming book "Clinton Cash," which is generating widespread headlines amid a flurry of reports suggesting it will raise serious questions about Clinton's family foundation.

The donor in question is Canadian mining executive Frank Giustra, a longtime friend of the former president who has given tens of millions to the Clinton Foundation in the past few years. (A couple of hours after the NYT story was published, Giustra issued a defiant statement. We've included that below.)

Becker initially wrote about the February 2007 meeting between Clinton, Giustra, and executives from the state-owned nuclear company Kazatomprom in 2008. The gathering took place at Clinton's home in Chappaqua, New York.

"When I first contacted both the Clinton foundation — Mr. Clinton's spokesman — and Mr. Giustra, they denied any such meeting ever took place," Becker recalled in footage aired by Fox News on Thursday.

However, Becker said Clinton and Giustra both changed their stories after she confronted them with evidence to the contrary.

"And then when we told them, 'Well we already talked to the head of Kazatomprom, who not only told us all about the meeting, but actually has a picture of him and Bill at the home in Chappaqua, and that he proudly displayed on his office wall.' They then acknowledged that yes, the meeting had taken place," Becker continued in the television interview.

The purpose of the meeting, then Kazatomprom President Moukhtar Dzhakishev told The Times, was to discuss Kazakhstan potentially buying a 10% stake in Westinghouse, a US nuclear company. Becker's 2008 story also noted one of Giustra's companies secured a deal to buy uranium deposits from Kazatomprom in 2005.

That agreement was made after Clinton accompanied Giustra on a trip to Kazakhstan. During the trip, Giustra and Clinton met with Kazakhstan's President Nursultan Nazarbayev.

Clinton issued a public statement praising the Kazakh leader despite his questionable, antidemocratic record. The Times called the praise a "propaganda coup" for Nazarbayev. (he later "won relection" w/ an unbelievable 90% of the vote)

"Just months after the Kazakh pact was finalized, Mr. Clinton's charitable foundation received its own windfall: a $31.3 million donation from Mr. Giustra that had remained a secret until he acknowledged it last month. The gift, combined with Mr. Giustra’s more recent and public pledge to give the William J. Clinton Foundation an additional $100 million, secured Mr. Giustra a place in Mr. Clinton’s inner circle," wrote Becker and another reporter, Don Van Natta.

A spokesperson for the Clinton Giustra Enterprise Partnership told Business Insider they are "working on a formal statement" in response to a request for comment on Thursday. Clinton Giustra Enterprise Partnership is an initiative of the Clinton Foundation that was cofounded by Clinton and Giustra in 2007. A Clinton Foundation spokesperson did not respond to a request for comment.

http://www.businessinsider.com/nyt-reporter-clinton-lied-about-meeting-2015-48/25

17 posted on 10/28/2017 4:07:47 AM PDT by Liz
[ Post Reply | Private Reply | To 15 | View Replies]

To: who_would_fardels_bear

Transliteration muddles the process of rendering the sense of what a Russian word or expression really means. It adds an extra step.

I was deployed to Uzbekistan where they had converted from Cyrillic to Latin lettering after 1991. However, it was much easier to learn some Russian since most Uzbeks still speak it. Our Russian teachers (Uzbek & Kazakh) started the class with transliterations; however, the learning process was made much simpler by plunging into Cyrillic and learning to hear it in the same fashion that we instinctively hear Latin letters written out.

One tool I used was to regard Cyrillic as modified Greek, which it is. This made learning it much simpler. And once past the alphabet barrier, Russian isn’t all that difficult.


18 posted on 10/28/2017 6:03:22 AM PDT by elcid1970 ("The Second Amendment is more important than Islam.")
[ Post Reply | Private Reply | To 14 | View Replies]

To: Olog-hai; rdl6989; SunkenCiv

Kazakh belongs to the Kipchak branch of the Turkic languages and earlier they used the https://en.wikipedia.org/wiki/Old_Turkic_alphabet

The new script is a modified form of the Latin alphabet, which is used to write not only English but many other languages, including Turkic ones related to Kazakh, such as Turkish.

But the version of Cyrillic the Soviets adopted was unnecessarily cumbersome, with 42 letters, including several representing sounds that do not occur in Kazakh, such as shch and ts. The new script will have a mere 32 letters: 23 ordinary Latin ones (c, w and x did not make the cut), and nine with apostrophes.

https://www.economist.com/news/asia/21730917-its-going-take-lot-diacritical-marks-kazakhstan-wants-kazakh-written-latin-not


19 posted on 11/05/2017 4:19:12 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 1 | View Replies]

To: AdmSmith
Thanks AdmSmith. It would have been amusing if they'd adapted the Turkish alphabet instead.

20 posted on 11/05/2017 10:57:00 PM PST by SunkenCiv (www.tapatalk.com/groups/godsgravesglyphs/, forum.darwincentral.org, www.gopbriefingroom.com)
[ Post Reply | Private Reply | To 19 | View Replies]

Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.

Free Republic
Browse · Search
General/Chat
Topics · Post Article

FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson