Free Republic
Browse · Search
General/Chat
Topics · Post Article


1 posted on 10/27/2017 9:34:09 PM PDT by Olog-hai
[ Post Reply | Private Reply | View Replies ]


To: Olog-hai

That’s a tiugh row to hoe.

At least they don’t have to switch directions too.


2 posted on 10/27/2017 9:40:46 PM PDT by Paladin2 (No spelchk nor wrong word auto substition on mobile dev. Please be intelligent and deal with it....)
[ Post Reply | Private Reply | To 1 | View Replies ]

To: Olog-hai

6 posted on 10/27/2017 10:11:52 PM PDT by Slyfox (Are you tired of winning yet?)
[ Post Reply | Private Reply | To 1 | View Replies ]

Hell yeah, ANSI rules!!!


11 posted on 10/27/2017 10:31:53 PM PDT by Gene Eric (Don't be a statist!)
[ Post Reply | Private Reply | To 1 | View Replies ]

To: Olog-hai
One of the most annoying consequences of political correctness in literature is the use of Cyrillic whenever Russian words are included in a text. So no more nyet or dos vedanya. Instead we see an indecipherable sequence of characters known only to those who studied Russian.

There are so many cool Russian words that people are missing out on because their latinized versions are no longer included.

Absolutely stupid and useless and tending toward separating people rather than bringing them together.

14 posted on 10/27/2017 11:09:41 PM PDT by who_would_fardels_bear
[ Post Reply | Private Reply | To 1 | View Replies ]

To: Olog-hai
The Foreign Ministry said in September that the switch to Latin script would also benefit Kazakhstan’s development.

Gee, I suggested this here about two weeks ago, but to bring Russia closer to the West.

15 posted on 10/28/2017 3:48:51 AM PDT by Does so (McAuliffe's Charlottesville...and...The Walter Duranty Press"...)
[ Post Reply | Private Reply | To 1 | View Replies ]

To: Olog-hai

Kazakhstan has the coolest sport ever: Kokpar.

Here’s an example from the 2017 world championships: Usa vs. Mongolia. I didn’t even know the USA had a Kokpar team. It’s safe to watch as nobody takes a knee for the anthem.

https://youtu.be/4Ill3YJtOhw


16 posted on 10/28/2017 4:04:23 AM PDT by j. earl carter
[ Post Reply | Private Reply | To 1 | View Replies ]

To: Olog-hai; rdl6989; SunkenCiv

Kazakh belongs to the Kipchak branch of the Turkic languages and earlier they used the https://en.wikipedia.org/wiki/Old_Turkic_alphabet

The new script is a modified form of the Latin alphabet, which is used to write not only English but many other languages, including Turkic ones related to Kazakh, such as Turkish.

But the version of Cyrillic the Soviets adopted was unnecessarily cumbersome, with 42 letters, including several representing sounds that do not occur in Kazakh, such as shch and ts. The new script will have a mere 32 letters: 23 ordinary Latin ones (c, w and x did not make the cut), and nine with apostrophes.

https://www.economist.com/news/asia/21730917-its-going-take-lot-diacritical-marks-kazakhstan-wants-kazakh-written-latin-not


19 posted on 11/05/2017 4:19:12 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 1 | View Replies ]

Free Republic
Browse · Search
General/Chat
Topics · Post Article


FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson