To: nickcarraway
Wasn’t there some horrible SNL skit where Chris Kattan (probably the most execrable SNL alum of all time) played a character called goatboy?
To: Slings and Arrows
Behind every screaming goat is a happy Muslim ping.
3 posted on
05/10/2016 11:02:21 PM PDT by
To Hell With Poverty
(Those who make peaceful revolution impossible will make violent revolution inevitable. ~ JFK ~)
To: nickcarraway
"He said research would be conducted on the kid's carcass to find out the reasons behind its human-looking features.
"This included investigating the possibility that the mother goat was violated by a human, he said."

4 posted on
05/10/2016 11:03:25 PM PDT by
Pelham
(Trump/Tsoukalos 2016 - vote the great hair ticket)
To: nickcarraway
That kind of love is not in the Bible!
7 posted on
05/10/2016 11:08:08 PM PDT by
WMarshal
(Trump 2016)
To: nickcarraway
To: nickcarraway
This disorder is caused by the nanny consuming the plants of the Veratrum family (Hellebore) early during her pregnancy. Ewes are also sensitive. The stage of pregnancy when the plant is consumed determines the nature of deformity, but generally the kids or lambs are born dead or die shortly after. If the plant is eaten late, the offspring grow too large to birth and the mothers die horrible deaths. This is tragic for animals and herdsmen alike.
13 posted on
05/10/2016 11:34:11 PM PDT by
stormer
To: nickcarraway
This included investigating the possibility that the mother goat was violated by a human, he said.What a moron.
14 posted on
05/10/2016 11:42:25 PM PDT by
Jeff Chandler
(Everywhere is freaks and hairies Dykes and fairies, tell me where is sanity?)
15 posted on
05/10/2016 11:43:54 PM PDT by
Gene Eric
(Don't be a statist!)
To: nickcarraway
Found in the Middle East right?
To: goat granny
17 posted on
05/11/2016 12:30:23 AM PDT by
Daffynition
("We have the fight of our lives coming up to save our nation!" ~ Jim Robinson)
To: nickcarraway
Only if you consider mooseSlimes to be human.
19 posted on
05/11/2016 1:50:04 AM PDT by
rawcatslyentist
(Genesis 1:29 And God said, Behold, I have given you every herb bearing seed,)
To: nickcarraway
“Johor to Test if Human-Looking Goat Is Offspring of Human and Animal”
No testing is necessary. Stupid muslims should open a freaking biology book.
22 posted on
05/11/2016 3:19:25 AM PDT by
Brooklyn Attitude
(It's the apocalypse, lets have some fun!)
To: nickcarraway
Baaaaaaaaaaaa-lahu Aaaaaaaaackbar.
25 posted on
05/11/2016 3:35:17 AM PDT by
60Gunner
(The price of apathy towards public affairs is to be ruled by evil men. - Plato)
To: nickcarraway
So who do you honor kill? The goat or the human?
26 posted on
05/11/2016 4:48:46 AM PDT by
DannyTN
To: nickcarraway
The Orson Wells movie “The island of Moriow” (the name ecsapes me) comes to mind...
27 posted on
05/11/2016 4:55:41 AM PDT by
Popman
(Christ alone: My Cornerstone...)
To: nickcarraway
Whatever it is isn’t Halal.
29 posted on
05/11/2016 4:58:41 AM PDT by
Dr. Sivana
("There is no limit to the amount of good you can do if you don't care who gets the credit."-R.Reagan)
To: nickcarraway
This included investigating the possibility that the mother goat was violated by a human, he said. Whoa! Hey Now, who are you to judge and impose your views of morality on this loving couple? You're just prejudiced against interspecies love and trying to shove your outdated religious beliefs down their throats. What two consenting mammals do within a loving relationship is none of your concern, they should have the same rights, including the right to marry as any other couple. /sarcasm (but I wouldn't put it past a liberal to actually make that argument)
32 posted on
05/11/2016 5:56:07 AM PDT by
apillar
To: nickcarraway
36 posted on
05/11/2016 12:20:06 PM PDT by
AdmSmith
(GCTGATATGTCTATGATTACTCAT)
To: nickcarraway
So just WAS Ibrahim Basir of Felda Sungai Mas doing around the goat pen in the middle of the night?
To: nickcarraway
41 posted on
05/11/2016 9:16:50 PM PDT by
dfwgator
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson