Free Republic
Browse · Search
General/Chat
Topics · Post Article

Skip to comments.

Panama Papers Reveal Clinton’s Kremlin Connection
Observer ^ | 4-7-16

Posted on 04/07/2016 11:23:53 AM PDT by InvisibleChurch

The revelations of the so-called Panama Papers that are roiling the world’s political and financial elites this week include important facts about Team Clinton. This unprecedented trove of documents purloined from a shady Panama law firm that arranged tax havens, and perhaps money laundering, for the globe’s super-rich includes juicy insights into how Russia’s elite hides its ill-gotten wealth.

Almost lost among the many revelations is the fact that Russia’s biggest bank uses The Podesta Group as its lobbyist in Washington, DC. Though hardly a household name, this firm is well known inside the Beltway, not least because its CEO is Tony Podesta, one of the best-connected Democratic machers in the country. He founded the firm in 1998 with his brother John, formerly chief of staff to President Bill Clinton, then counselor to President Barack Obama, Mr. Podesta is the very definition of a Democratic insider. Outsiders engage the Podestas and their well-connected lobbying firm to improve their image and get access to Democratic bigwigs.

(Excerpt) Read more at observer.com ...


TOPICS: Chit/Chat
KEYWORDS: 1998; 201604; bp; britishpetroleum; brookings; c4ap; california; cap; cfap; cfr; clinton; electricgrid; electricity; erhard; erhardmossack; fonseca; goldman; goldmansachs; heidicruz; hillaryclinton; icij; johnpodesta; kremlin; mossack; mossackfonseca; nbcuniversal; neweastnetwork; nwo; obama; panamapapers; podesta; podestagroup; putin; ramn; russia; sberbank; sec; sonnenfeldt; soros; tafta; thepodestagroup; tisa; tonypodesta; tpa; tpp; waffenss
.
1 posted on 04/07/2016 11:23:53 AM PDT by InvisibleChurch
[ Post Reply | Private Reply | View Replies]

To: Blue Jays

Negative impact to the Teflon Clintons = absolutely nothing.

2 posted on 04/07/2016 11:30:52 AM PDT by Blue Jays (Rock Hard, Ride Free)
[ Post Reply | Private Reply | To 1 | View Replies]

To: InvisibleChurch

Obama’s Links to Big Oil
http://www.thenewamerican.com/usnews/politics/item/3181-obamas-links-to-big-oil

23 June 2010

...
John Podesta is the head of the Soros’ Center for American Progress. His brother, Tony Podesta, is the lobbyist for British Petroleum. John and Tony also started their own lobbying company together, an apparent conflict of interest given the current situation in the Gulf.

In addition to BP, Tony Podesta’s clients include NBC Universal, a company that is owned by General Electric, the company that provided the smart grid for California, recommended by the Center for American Progress.

Could it be that the tangled web Obama weaves grows more sticky — or is this all a mere coincidence?
...


3 posted on 04/07/2016 11:30:57 AM PDT by VitacoreVision
[ Post Reply | Private Reply | To 1 | View Replies]

To: InvisibleChurch

“The majority stockholder in Sberbank is Russia’s Central Bank. In other words, Sberbank is functionally an arm of the Kremlin, although it’s ostensibly a private institution”
“A NATO counterintelligence official explained that Sberbank, ...“functions as a sort of arm of the SVR outside Russia, especially because many of its senior employees are ‘former’ Russian intelligence officers.”


4 posted on 04/07/2016 11:38:29 AM PDT by nuconvert ( Khomeini promised change too // Hail, Chairman O)
[ Post Reply | Private Reply | To 1 | View Replies]

To: VitacoreVision

#3 ~ Could it be that the tangled web Obama weaves grows more sticky — or is this all a mere coincidence?

Now, THAT IS FUNNY!


5 posted on 04/07/2016 11:40:08 AM PDT by heterosupremacist ("Resistance to tyrants is obedience to God." Thomas Jefferson)
[ Post Reply | Private Reply | To 3 | View Replies]

To: InvisibleChurch
Panama Papers Reveal Clinton’s Kremlin Connection

Johnny Chung and the Chinese Commies are going to be jealous, they've been forced to compete with Soros, EU and Ukranian payoffs.

6 posted on 04/07/2016 11:45:41 AM PDT by Navy Patriot (America, a Rule of Mob nation)
[ Post Reply | Private Reply | To 1 | View Replies]

To: VitacoreVision

And why does anyone act surprised at this? We don’t have a group of elites running our country, they are running the world. The American members of this group, most of whom live in New York and Washington, are easily comfortable with their counterparts in London, Berlin, Moscow, Riyadh, Beijing, Shanghai and Tokyo. They are far more comfortable with each other than they are with any of us.

Basically, the members of that club are loyal to the club first, and as for us?

We

just

don’t

matter.


7 posted on 04/07/2016 11:46:17 AM PDT by henkster
[ Post Reply | Private Reply | To 3 | View Replies]

To: InvisibleChurch

BTTT.


8 posted on 04/07/2016 11:50:40 AM PDT by PA Engineer (Liberate America from the Occupation Media. #2ndAmendmentMatters)
[ Post Reply | Private Reply | To 1 | View Replies]

To: InvisibleChurch

I think John Pedestal is almost as slimy as Sid Blumenthal.


9 posted on 04/07/2016 11:54:47 AM PDT by surrey
[ Post Reply | Private Reply | To 1 | View Replies]

To: surrey

It’s too close to call


10 posted on 04/07/2016 11:57:28 AM PDT by nuconvert ( Khomeini promised change too // Hail, Chairman O)
[ Post Reply | Private Reply | To 9 | View Replies]

“Since the brothers Podesta are presumably destined for very high-level White House jobs next January if the Democrats triumph in November ...”

I’d say their connections should make it impossible for them to do so


11 posted on 04/07/2016 12:03:41 PM PDT by nuconvert ( Khomeini promised change too // Hail, Chairman O)
[ Post Reply | Private Reply | To 4 | View Replies]

To: InvisibleChurch
Mr. Podesta is the very definition of a Democratic insider......an Obama and the Clinton Crime Family surrogate....as a Marxist he has Van Jones and other Communist working for him....

Hey Trump people....are you watching?

12 posted on 04/07/2016 12:06:09 PM PDT by yoe
[ Post Reply | Private Reply | To 1 | View Replies]

To: InvisibleChurch

What about the 400+ US clients ? That’s a “little black book” that the clients sure as hell don’t want revealed. Kremlin, who gives a rip about them? Curious what US politicians are in this up to their neck.


13 posted on 04/07/2016 12:20:41 PM PDT by csvset ( Illegitimi non carborundum)
[ Post Reply | Private Reply | To 1 | View Replies]

To: csvset
Curious what US politicians are in this up to their neck.

All but the really dumb ones even some from Texas.

14 posted on 04/07/2016 1:49:15 PM PDT by itsahoot (Trump is a fumble mouthed blowhard that can't finish a sentence, but he will finish a term.)
[ Post Reply | Private Reply | To 13 | View Replies]

To: yoe

what?


15 posted on 04/07/2016 4:49:00 PM PDT by SgtHooper (If you remember the 60's, YOU WEREN'T THERE!)
[ Post Reply | Private Reply | To 12 | View Replies]

To: nuconvert; SunkenCiv; Dog; Straight Vermonter; Cap Huff; ASA Vet
An now we have another twist on the story:

In sum, my thinking is that this could have been a Russian intelligence operation, which orchestrated a high-profile leak and established total credibility by “implicating” (not really implicating) Russia and keeping the source hidden. Some documents would be used for anti-corruption campaigns in a few countries—topple some minor regimes, destroy a few careers and fortunes. By then blackmailing the real targets in the United States and elsewhere (individuals not in the current leak), the Russian puppet masters get “kontrol” and influence.

If the Russians are behind the Panama Papers, we know two things and both come back to Putin personally: First, it is an operation run by RFM, which means it’s run by Putin; second, it’s ultimately about blackmail. That means the real story lies in the information being concealed, not revealed. You reveal secrets in order to destroy; conceal in order to control. Putin is not a destroyer. He’s a controller.

http://www.brookings.edu/blogs/order-from-chaos/posts/2016/04/07-panama-papers-putin-gaddy

Jim https://en.wikipedia.org/wiki/James_Jesus_Angleton where are you when we need you?

16 posted on 04/08/2016 7:37:36 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 4 | View Replies]

To: AdmSmith

“Putin is not a destroyer. He’s a controller.”

He’s both


17 posted on 04/08/2016 9:34:05 AM PDT by nuconvert ( Khomeini promised change too // Hail, Chairman O)
[ Post Reply | Private Reply | To 16 | View Replies]

To: InvisibleChurch

https://www.mcclatchydc.com/news/politics-government/election/article72215012.html

“Inside Panama Papers: Multiple Clinton connections”

By Anita Kumar, Marisa Taylor and Kevin G. Hall

McClatchy Washington Bureau

Except:

“Among them are Gabrielle Fialkoff, finance director for Hillary Clinton’s first campaign for the U.S. Senate; Frank Giustra, a Canadian mining magnate who has traveled the globe with Bill Clinton; a member of the Chagoury family, which pledged $1 billion in projects to the Clinton Global Initiative; and Chinese billionaire Ng Lap Seng, who was at the center of a Democratic fund-raising scandal when Bill Clinton was president. Also using the Panamanian law firm was the company founded by the late billionaire investor Marc Rich, an international fugitive when Bill Clinton pardoned him in the final hours of his presidency.

The ties are both recent and decades old, not surprising for the Democratic presidential front-runner and her husband, who have been in public life since the 1970s.....”

More at link

Read more here: https://www.mcclatchydc.com/news/politics-government/election/article72215012.html#storylink=cpy

6 posted on 2/19/2020, 3:04:24 PM by Pete from Shawnee Mission


18 posted on 03/30/2021 9:18:09 PM PDT by piasa (Attitude adjustments offered here free of charge)
[ Post Reply | Private Reply | To 1 | View Replies]

Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.

Free Republic
Browse · Search
General/Chat
Topics · Post Article

FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson