1 posted on
11/23/2013 5:57:05 PM PST by
BenLurkin
To: BenLurkin
Dual primes are my favorite type of numbers.
2 posted on
11/23/2013 5:59:51 PM PST by
Paladin2
To: BenLurkin
“Math is HARD!” ~ Barbie...and Diana in Wisconsin, LOL!
3 posted on
11/23/2013 6:01:53 PM PST by
Diana in Wisconsin
(I don't have 'Hobbies.' I'm developing a robust Post-Apocalyptic skill set...)
To: BenLurkin
I’ve been saying that for years. (/s)
To: BenLurkin
Thanks for posting. Interesting stuff.
The internet is obviously helping to advance research by speeding communication and enabling collaboration. Once the concept of a bounded gap was introduced everyone piled on.
7 posted on
11/23/2013 6:06:50 PM PST by
MV=PY
(The Magic Question: Who's paying for it?)
To: BenLurkin
Wait, WHAT?... ugh.. Is there going to be a test at the end? OMG, I hope not.. :)
9 posted on
11/23/2013 6:15:32 PM PST by
carlo3b
(RUFFLE FEATHERS, and destroy their FEATHER NEST!)
To: BenLurkin
Most integers are very large.
10 posted on
11/23/2013 6:15:43 PM PST by
Scrambler Bob
( Concerning bo -- that refers to the president. If I capitalize it, I mean the dog.)
To: BenLurkin
One One is the loneliest number that you’ll ever do.
11 posted on
11/23/2013 6:18:38 PM PST by
DManA
(rs)
To: BenLurkin
14 posted on
11/23/2013 6:20:15 PM PST by
Vendome
(Don't take life so seriously-you won't live through it anyway-Enjoy Yourself ala Louis Prima)
To: BenLurkin
This has implications for the security of public key cryptography.
To: BenLurkin
20 posted on
11/23/2013 6:27:06 PM PST by
lyby
("Mathematics is the language with which God has written the universe." ~ Galileo Galilei)
To: BenLurkin
Isn’t it logical that if there are infinite base systems (base-2 binary, base 16 hexadecimal, etc.) then there ought to be infinite prime numbers?
Our base-10 numbers are just a coincidence that the Indians invented and was adopted worldwide. The Sumerians were doing base-12, but the Indians had the convenient zero.
To: BenLurkin; a fool in paradise
Western Civilization would have been so much better off if it had stayed with Roman numerals.
37 posted on
11/23/2013 6:58:01 PM PST by
Revolting cat!
(Bad things are wrong! Ice cream is delicious!)
To: BenLurkin; a fool in paradise
47 posted on
11/23/2013 7:25:19 PM PST by
Revolting cat!
(Bad things are wrong! Ice cream is delicious!)
To: BenLurkin
“Numba. Numba. Too many numba.” —Vic Ten
50 posted on
11/23/2013 7:31:09 PM PST by
onedoug
>> If at some point, prime numbers are always more than two numbers away from each other, we have a non-random aspect to their distribution that goes against this intuition.
Gibberish.
This is not a property of prime numbers.
61 posted on
11/23/2013 10:52:59 PM PST by
Gene Eric
(Don't be a statist!)
To: BenLurkin
What if 6 turned out to be 9?
65 posted on
11/24/2013 9:09:54 AM PST by
Walmartian
(I'm their leader. Which way did they go?)
To: BenLurkin
My favorite "prime".
![](http://www.webersinn.com/boutiquehotel/wp-content/gallery/restaurant-slideshow/restaurant_primerib_600x340.jpg)
66 posted on
11/24/2013 9:22:08 AM PST by
Bratch
To: BenLurkin
How complete of an understanding do you need to know that it goes on forever?
![](http://d2tq98mqfjyz2l.cloudfront.net/image_cache/1383634561470070_animate.gif)
Cant I get a gov't grant for my studies?
67 posted on
11/24/2013 9:27:52 AM PST by
Delta 21
(If you like your freedom, you can keep your freedom. Period.)
To: BenLurkin
Why are some numbers prime and the rest, not? Oh, yeah, you can tell all those divisibility stories you like, but the truth is that they're members of a privileged class lording it over all the rest, white capitalist racist imperialist OPPRESSORS.
Prime numbers, bah. Those of us who understand truly advanced social theory don't need math.
To: BenLurkin; SunkenCiv
73 posted on
11/26/2013 4:28:13 AM PST by
AdmSmith
(GCTGATATGTCTATGATTACTCAT)
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson