Free Republic
Browse · Search
General/Chat
Topics · Post Article

Skip to comments.

MIT researchers find that Sirtuin1 may boost memory and learning ability
Massachusetts Institute of Technology ^ | July 11, 2010 | Unknown

Posted on 07/11/2010 1:25:25 PM PDT by decimon

Discovery could lead to new drugs to fight Alzheimer's, other neurological diseases

CAMBRIDGE, Mass. — The same molecular mechanism that increases life span through calorie restriction may help boost memory and brainpower, researchers at MIT's Picower Institute for Learning and Memory report in the July 11 issue of Nature.

Resveratrol, found in wine, has been touted as a life-span enhancer because it activates a group of enzymes known as sirtuins, which have gained fame in recent years for their ability to slow the aging process. Now MIT researchers report that Sirtuin1 — a protein that in humans is encoded by the SIRT1 gene — also promotes memory and brain flexibility.

The work may lead to new drugs for Alzheimer's disease and other debilitating neurological diseases.

"We demonstrated previously that Sirtuin1 promotes neuronal survival in age-dependent neurodegenerative disorders. In our cell and mouse models for Alzheimer's disease, SIRT1 promoted neuronal survival, reduced neurodegeneration and prevented learning impairment," said Li-Huei Tsai, director of the Picower Institute and lead author of the study.

"We have now found that SIRT1 activity also promotes plasticity and memory," said Tsai, Picower Professor of Neuroscience and a Howard Hughes Medical Institute investigator. "This result demonstrates a multi-faceted role of SIRT1 in the brain, further highlighting its potential as a target for the treatment of neurodegeneration and conditions with impaired cognition, with implications for a wider range of central nervous system disorders."

In separate work at MIT, researchers discovered that the sir2 (silent information regulator) gene is a key regulator of longevity in both yeast and worms. Ongoing studies are exploring whether this highly conserved gene also governs longevity in mammals.

The mammalian version of the gene, SIRT1, seems to have evolved complex systemic roles in cardiac function, DNA repair and genomic stability. SIRT1 is thought to be a key regulator of an evolutionarily conserved pathway that allows organisms to cope with adversity. These genes and the enzymes they produce are part of a feedback system that enhances cell survival during times of stress, especially a lack of food.

Recent studies linked SIRT1 to normal brain physiology and neurological disorders. However, it was unknown if SIRT1 played a role in higher-order brain functions.

The Picower Institute study shows that SIRT1 enhances synaptic plasticity, the connections among neurons, and memory formation. These findings demonstrate a new role for SIRT1 in cognition and a previously unknown mechanism by which SIRT1 regulates these processes.

MicroRNAs are small RNA molecules encoded in the genomes of plants and animals. These gene regulators are involved in many aspects of normal and abnormal brain function. The Picower study found that SIRT1 aids memory and synaptic plasticity through a previously unknown microRNA-based mechanism: SIRT1 keeps a specific microRNA in check, allowing key plasticity proteins to be expressed.

In addition to helping neurons survive, SIRT1 also has a direct role in regulating normal brain function, demonstrating its value as a potential therapeutic target for the treatment of the central nervous system.

###

Source: "A novel pathway regulates memory and plasticity via SIRT1 and miR-134," Jun Gao Wen-Yuan Wang, Ying-Wei Mao, Johannes Gräff, Ji-Song Guan, Ling Pan, Gloria Mak, Dohoon Kim, Susan C. Su and Li-Huei Tsai, in the July 11 issue of Nature.


TOPICS: Health/Medicine; Science
KEYWORDS: creb; sirt1; winoman

1 posted on 07/11/2010 1:25:27 PM PDT by decimon
[ Post Reply | Private Reply | View Replies]

To: neverdem; DvdMom; grey_whiskers

Ping


2 posted on 07/11/2010 1:26:09 PM PDT by decimon
[ Post Reply | Private Reply | To 1 | View Replies]

To: decimon

If this stiff is in scotch whisky or cigars then I am set for a very long life of wisdom....


3 posted on 07/11/2010 1:27:39 PM PDT by devane617 (VOTE THEM OUT! ALL OF THEM!)
[ Post Reply | Private Reply | To 1 | View Replies]

To: decimon

There are days when I could use a boat load of this stuff!


4 posted on 07/11/2010 1:29:09 PM PDT by basil (It's time to rid the country of "Gun Free Zones" aka "Killing Fields")
[ Post Reply | Private Reply | To 1 | View Replies]

To: devane617
If this stiff is in scotch whisky or cigars then I am set for a very long life of wisdom....

Well, when you're stiff, you're stiff. ;-)

5 posted on 07/11/2010 1:34:32 PM PDT by decimon
[ Post Reply | Private Reply | To 3 | View Replies]

To: devane617

Hitting the Scotch early today, are we?

(Just kidding. ;)


6 posted on 07/11/2010 1:38:36 PM PDT by Fantasywriter
[ Post Reply | Private Reply | To 3 | View Replies]

To: decimon

bflr


7 posted on 07/11/2010 1:39:17 PM PDT by Captain Beyond (The Hammer of the gods! (Just a cool line from a Led Zep song))
[ Post Reply | Private Reply | To 1 | View Replies]

To: decimon

That’ll be the next excuse for getting smashed or drunk.


8 posted on 07/11/2010 1:40:38 PM PDT by nmh (Intelligent people recognize Intelligent Design (God).)
[ Post Reply | Private Reply | To 1 | View Replies]

To: decimon

That’ll be the next excuse for getting smashed or drunk.


9 posted on 07/11/2010 1:40:47 PM PDT by nmh (Intelligent people recognize Intelligent Design (God).)
[ Post Reply | Private Reply | To 1 | View Replies]

To: nmh

looks like you forgot that you posted your response before....
; )


10 posted on 07/11/2010 1:54:10 PM PDT by Walkingfeather
[ Post Reply | Private Reply | To 9 | View Replies]

To: decimon

Link does not match description of link


11 posted on 07/11/2010 1:55:10 PM PDT by AppyPappy (If you aren't part of the solution, there is good money to be made prolonging the problem.)
[ Post Reply | Private Reply | To 1 | View Replies]

To: decimon
Resveratrol, found in wine, has been touted as a life-span enhancer because it activates a group of enzymes known as sirtuins, which have gained fame in recent years for their ability to slow the aging process.

No wonder I look so damn good ... ;o)

12 posted on 07/11/2010 2:02:42 PM PDT by BluH2o
[ Post Reply | Private Reply | To 1 | View Replies]

To: Walkingfeather
I don't know what it is ... but lately it's so slllooowww to post that I click “post” again. Sometimes it only posts once and other times it's twice.
13 posted on 07/11/2010 2:07:39 PM PDT by nmh (Intelligent people recognize Intelligent Design (God).)
[ Post Reply | Private Reply | To 10 | View Replies]

To: AppyPappy
Link does not match description of link

It does for me.

Now for the standard responses:

Are you logged in?

Moose.

Cheese.

Sister.

Thailand?

Your beeber stuned?

14 posted on 07/11/2010 2:26:14 PM PDT by decimon
[ Post Reply | Private Reply | To 11 | View Replies]

To: decimon; texas booster
Thanks decimon. I checked my pings for something like this. Sometimes I don't, like my mail.

A novel pathway regulates memory and plasticity via SIRT1 and miR-134

CREB involved again!

Protein regulator shows promise against addiction

15 posted on 07/11/2010 8:56:24 PM PDT by neverdem (Xin loi minh oi)
[ Post Reply | Private Reply | To 2 | View Replies]

To: decimon

19 studies of Resveratrol: http://www.clinicaltrials.gov/ct2/results?term=Resveratrol

one is referring to Sirtuin1

http://www.clinicaltrials.gov/ct2/show/NCT00654667

one about memory: http://www.clinicaltrials.gov/ct2/show/NCT01126229


16 posted on 07/12/2010 4:12:07 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 1 | View Replies]

Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.

Free Republic
Browse · Search
General/Chat
Topics · Post Article

FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson