Posted on 08/07/2007 9:30:37 AM PDT by GodGunsGuts
RIVERSIDE, Calif. – A research team, including UC Riverside biologists, has found experimental evidence that supports a controversial theory of genetic conflict in the reproduction of those animals that support their developing offspring through a placenta.
The conflict has been likened to a “battle of the sexes” or an “arms race” at the molecular level between mothers and fathers. At stake: the fetus’s growth rate and how much that costs the nutrient-supplying mother.
The new research supports the idea of a genetic “arms race” going on between a live-bearing mother and her offspring, assisted by the growth-promoting genes of the father...
(Excerpt) Read more at eurekalert.org ...
Menes of Egypt who united the Upper and Lower Kingdoms, and the ‘Ice-man’ found in the alps are almost contemporaries. The Egyptians wouldn’t have copper tools until after the Hyksos invaders, but the ‘Ice-man’ had them. I dont think the ‘flame of civilization’ idea of it spreading out from Babylon and Egypt holds much water. People were people and did different things, built boats, used neat tools, domesticated species, but until Agriculture, there couldn’t be Civilization in the form that leaves evidence of a civilization. The ‘Ice-man’ wasn’t waiting to get out of the ‘stone-age’ by the influence from Egypt.
Obviously, he didn't need an "Egyptian" to tailor his clothes for him, either, made of hide, though they were.
I do not notice them saying the same thing about their finding that you are saying.
Inai Y, Ohta Y, Nishikimi M. 2003
Department of Biochemistry, Wakayama Medical University, 811-1 Kimiidera, Wakayama 641-0012, Japan.
L-Gulono-gamma-lactone oxidase (GULO), which catalyzes the last step of ascorbic acid biosynthesis, is missing in humans. The whole structure of the human gene homologue for this enzyme was disclosed by a computer-assisted search. Only five exons, as compared to 12 exons constituting the functional rat GULO gene, remain in the human genome. A comparison of these exons with those of their functional counterparts in rat showed that there are two single nucleotide deletions, one triple nucleotide deletion, and one single nucleotide insertion in the human sequence. When compared in terms of codons, the human sequence has a deletion of a single amino acid, two stop codons, and two aberrant codons missing one nucleotide besides many amino acid substitutions. A comparison of the remaining human exon sequences with the corresponding sequences of the guinea pig nonfunctional GULO gene revealed that the same substitutions from rats to both species occurred at a large number of nucleotide positions. From analyses of the molecular evolution of Alu sequences in the human GULO gene homologue, it is thought that two Alu sequences were inserted in the vicinity of a presumed position of lost exon 11 during the same period as GULO lost its function. It is predicted that six LINE-1 sequences located in and near the gene homologue were inserted not during that period.
PMID: 14703305 [PubMed - indexed for MEDLINE]
Nishikimi M, Kawai T, Yagi K.
Institute of Applied Biochemistry, Yagi Memorial Park, Gifu, Japan.
Guinea pigs cannot synthesize L-ascorbic acid because of their deficiency in L-gulono-gamma-lactone oxidase, a key enzyme for the biosynthesis of this vitamin in higher animals. In this study we isolated the L-gulono-gamma-lactone oxidase gene of the rat and the homologue of this gene of the guinea pig by screening rat and guinea pig genomic DNA libraries in lambda phage vectors, respectively, using a rat L-gulono-gamma-lactone oxidase cDNA as a probe. Sequencing analysis showed that the amino acid sequence of the rat enzyme is encoded by 12 exons and that all the intron/exon boundaries follow the GT/AG rule. On the other hand, regions corresponding to exons I and V were not identified in the guinea pig L-gulono-gamma-lactone oxidase gene homologue. Other defects found in this gene homologue are a deletion of the nucleotide sequence corresponding to a 3’ 84-base pair part of rat exon VI, a 2-base pair deletion in the remaining exon VI-related region, and nonconformance to the GT/AG rule at one of the putative intron/exon boundaries. Furthermore, a large number of mutations were found in the amino acid-coding regions of the guinea pig sequence; more than half of them lead to nonconservative amino acid changes, and there are three stop codons as well. Thus it is clear that the guinea pig homologue of the L-gulono-gamma-lactone oxidase gene exists as a pseudogene that randomly accumulated a large number of mutations without functional constraint since the gene ceased to be active during evolution. On the basis of the neutral theory of evolution, the date of the loss of L-gulono-gamma-lactone oxidase in the ancestors of the guinea pig was roughly calculated to be less than 20 million years ago.
PMID: 1400507 [PubMed - indexed for MEDLINE]
Sedentism and agricultural surpluses?
http://bioweb.pasteur.fr/seqanal/interfaces/matcher.html
########################################
# Program: matcher
# Rundate: Sat Aug 18 17:25:47 2007
# Align_format: markx0
# Report_file: outfile.align
########################################
#=======================================
#
# Aligned_sequences: 2
# 1: humans
# 2: pan tr
# Matrix: EDNAFULL
# Gap_penalty: 16
# Extend_penalty: 4
#
# Length: 116
# Identity: 114/116 (98.3%)
# Similarity: 114/116 (98.3%)
# Gaps: 0/116 ( 0.0%)
# Score: 562
#
#
#=======================================
10 20 30 40 50
humans AGTTCCTCCATAGCCTGGACAGCATTGGAAGAAATCTGAGGACTTCTGCT
::::::::::::::::::::::::::::::::::::::::::::: ::::
pan tr AGTTCCTCCATAGCCTGGACAGCATTGGAAGAAATCTGAGGACTTTTGCT
10 20 30 40 50
60 70 80 90 100
humans TCCTCTGGTTCCCACACAGTGAGAACGTCAGTGCCATCCACCAGGACCAC
::::::::::::::::::: ::::::::::::::::::::::::::::::
pan tr TCCTCTGGTTCCCACACAGCGAGAACGTCAGTGCCATCCACCAGGACCAC
60 70 80 90 100
110
humans ACCAGCAAGGCAGCTG
::::::::::::::::
pan tr ACCAGCAAGGCAGCTG
110
########################################
# Program: matcher
# Rundate: Sat Aug 18 17:10:16 2007
# Align_format: markx0
# Report_file: outfile.align
########################################
#=======================================
#
# Aligned_sequences: 2
# 1: humans
# 2: g-pigs
# Matrix: EDNAFULL
# Gap_penalty: 16
# Extend_penalty: 4
#
# Length: 90
# Identity: 74/90 (82.2%)
# Similarity: 74/90 (82.2%)
# Gaps: 1/90 ( 1.1%)
# Score: 294
#
#
#=======================================
10 20 30 40
humans CAGTTCCTCCATAGCCTGGACAGC-ATTGGAAGAAATCTGAGGACTTCTG
::: ::::: : : ::: :::::: :: :::::: : :: :::::::
g-pigs CAGGTCCTCGACAACCTTGACAGCCATCTGAAGAAGTTCAAGTACTTCTG
30 40 50 60 70
50 60 70 80
humans CTTCCTCTGGTTCCCACACAGTGAGAACGTCAGTGCCATC
:::::: :::::::::::::: ::::::::::::: ::::
g-pigs CTTCCTGTGGTTCCCACACAGCGAGAACGTCAGTGTCATC
80 90 100 110
#-———————————————————
#-———————————————————
########################################
# Program: matcher
# Rundate: Sat Aug 18 17:11:27 2007
# Align_format: markx0
# Report_file: outfile.align
########################################
#=======================================
#
# Aligned_sequences: 2
# 1: humans
# 2: RatusN
# Matrix: EDNAFULL
# Gap_penalty: 16
# Extend_penalty: 4
#
# Length: 118
# Identity: 93/118 (78.8%)
# Similarity: 93/118 (78.8%)
# Gaps: 1/118 ( 0.8%)
# Score: 353
#
#
#=======================================
10 20 30 40
humans CAGTTCCTCCATAGCCTGGACAGC-ATTGGAAGAAATCTGAGGACTTCTG
::: :::: : : ::: :::::: : ::::: :::::: ::::: :
RatusN CAGGTCCTTGACAACCTAGACAGCCACCTGAAGAGGTCTGAGTACTTCCG
10 20 30 40 50
50 60 70 80 90
humans CTTCCTCTGGTTCCCACACAGTGAGAACGTCAGTGCCATCCACCAGGACC
:::::::::::: :: :::: :::::::::::: :::: :::: ::::
RatusN CTTCCTCTGGTTTCCTCACACTGAGAACGTCAGCATCATCTACCAAGACC
60 70 80 90 100
100 110
humans ACACCAGCAAGGCAGCTG
:::::: ::::: : :::
RatusN ACACCAACAAGGTAACTG
110
#-———————————————————
#-———————————————————
########################################
# Program: matcher
# Rundate: Sat Aug 18 17:12:51 2007
# Align_format: markx0
# Report_file: outfile.align
########################################
#=======================================
#
# Aligned_sequences: 2
# 1: g-pigs
# 2: RatusN
# Matrix: EDNAFULL
# Gap_penalty: 16
# Extend_penalty: 4
#
# Length: 91
# Identity: 76/91 (83.5%)
# Similarity: 76/91 (83.5%)
# Gaps: 0/91 ( 0.0%)
# Score: 320
#
#
#=======================================
30 40 50 60 70
g-pigs CAGGTCCTCGACAACCTTGACAGCCATCTGAAGAAGTTCAAGTACTTCTG
:::::::: :::::::: :::::::: ::::::: :: :::::::: :
RatusN CAGGTCCTTGACAACCTAGACAGCCACCTGAAGAGGTCTGAGTACTTCCG
10 20 30 40 50
80 90 100 110
g-pigs CTTCCTGTGGTTCCCACACAGCGAGAACGTCAGTGTCATCT
:::::: ::::: :: :::: ::::::::::: ::::::
RatusN CTTCCTCTGGTTTCCTCACACTGAGAACGTCAGCATCATCT
60 70 80 90
#-———————————————————
#-———————————————————
http://www.pnas.org/cgi/content/full/96/18/10254
The genomes of modern humans are riddled with thousands of endogenous retroviruses (HERVs), the proviral remnants of ancient viral infections of the primate lineage. Most HERVs are nonfunctional, selectively neutral loci. This fact, coupled with their sheer abundance in primate genomes, makes HERVs ideal for exploitation as phylogenetic markers.
http://mbe.oxfordjournals.org/cgi/reprint/8/2/155
the evidence from proteins and DNA has consistently supported a monophyletic grouping of gibbons, great apes, and humans. This macromolecular evidence includes that from protein immunology (Goodman 1963; Hafleigh and Williams 1966; Sarich and Wilson 1967; Goodman and Moore 197 1; Dene et al. 1976; Sarich and Cronin 1976), from DNA-DNA hybridization (Hoyer et al. 1972; Kohne 1975; Benveniste and Todaro 1976; Sibley and Ahlquist 1984, 1987; Caccone and Powell 1989), from sequencing mtDNA (Brown et al. 1982; Hayasaka et al., 1988),and from sequencing nuclear DNA, such as that of the involucrin gene (Djian and Green 1990) and portions of the genomic domain containing p-type globin genes (Fitch et al. 1990; Goodman et al. 1990; present study).
We report here, for the common gibbon (H. lar), the DNA sequence of an 8.4- kb region encompassing the t+m gene, a nonfunctional member of the P-like globin gene family (Fritsch et al. 1980; Jagadeeswaran et al. 1982; Goodman et al. 1984; Harris et al. 1984). We also present, for galago (G&go crussicaudutus), a strepsirhine primate, the complete DNA sequence over the 5’ flanking region of the ~1 locus, as well as the previously reported sequence over the exons and introns of the tlm locus (Koop et al. 198gb). The vrl-globin gene occurs in a genomic domain called the “pglobin gene cluster.” This domain in mammalian genomes arose from a series of tandem gene duplications that began 150-200 Mya and that, by the time of the early eutherian mammals (80- 100 Mya), had resulted in five paralogously related genes linked in the order 5’+y-t#3-3’ (Goodman et al. 1984; Harris et al. 1984). Divergence and parsimony analyses indicate that the n-globin locus originated from an embryonically expressed prom-epsilon gene (Goodman et al. 1984,1987; Koop and Goodman 1988).
Pseudogenes, since they no longer contribute to the phenotype, are released from purifying or stabilizing selection which eliminates variation and from positive directional selection which is reflected by adaptive variation. Therefore, pseudogenes and other noncoding DNA lacking regulatory or structural functions should accumulate mutations at rates approximating the rates of occurrence of spontaneous mutations (Kimura 1983). In resolving cladistic relationships over short phylogenetic distances, such noncoding DNA offers advantages over coding DNA. The noncoding sequences, compared with the coding sequences, accumulate nucleotide changes at a more rapid rate (Gojobori et al. 1982; Li et al. 1984). Also, they accumulate changes independently of natural selection; therefore, shared changes more frequently reflect changes shared through history, rather than changes through parallel function. In the present study,
noncoding DNA that spans the vn-globin locus was chosen to answer phylogenetic questions regarding placement of the common gibbon among the simian primates, as well as other evolutionary questions regarding molecular clocks and rates of DNA evolution.
A little of both.
Agriculure alone did not cause the huge changes we have seen over the last 10,000 years. But when combined with surpluses, leading to walled cities (to protect the surpluses from raiders), craft specialization, accounting (writing), organized armies (to protect the surpluses), and other developments you begin to see the large-scale changes previous posts were mentioning.
WRT the above: You and I are completely on the same page, allmendream! But tell that to Nobel laureate in biology, Jacques Monod. He says that life and all of nature are the products of "pure, blind chance." Period.
Undeniably, there is that sentiment out there in the culture....
While I'd truly enjoy a further discussion of randomness in nature and QM, I did promise to be only a "fly on the wall," so will wait for another time.
Maybe you'll tell me when that is. :^)
Thank you so much for your beautiful essay/post allmendream!
Amen, that is it exactly, my dearest sister in Him!
All praise and glory to our Lord!
Its got to hurt Monsieur Monod that humans evolving by random chance would eventually evolve into creatures that would invent GOD.. Bringing the concept that maybe lifeforms through evolution would gravitate to a belief in some sort of GOD..
That is when intellect gets bold and complex enough, God is contemplated.. Must hurt.. that atheists and some biologists are lower forms of evolution.. That only seems logical.. There is no doubt with all the human history that mankind has sought a God.. and if they didn't have one they invented one.. Human history is littered with primitive Cargo Cultists and sophisticated Cargo Cultists.. Modern science is an effort in Cargo Cultism.. Information is the "IDOL" and observations of that information is the Cargo packaged in mostly neat little packages..
Amazing that this view or observation has missed them ALL..
Probably they havn't evolved enough YET.. to observe the OBVIOUS..
Ok. Reasonable enough...
If by that you mean said hotspots giving the illusion of common descent, then you are correct. I pointed you to another scientist (Peter Borger) who reinterpreted the data to arrive at that conclusion. But if you are simply talking about the hotspots themselves, then you are wrong:
“A comparison of the remaining human exon sequences with the corresponding sequences of the guinea pig nonfunctional GULO gene revealed that the same substitutions from rats to both species occurred at a large number of nucleotide positions.”
—Inai Y, Ohta Y, Nishikimi M. Department of Biochemistry, Wakayama Medical University, 811-1 Kimiidera, Wakayama 641-0012, Japan.
BUT LET US FOCUS ON THE TRULY IMPORTANT FIND RE: COMMON DESCENT...
Peter Borger simply combines the GULO (Vitamin C synthase) sequences of Ohta & Nishikimi, 1999 (rat, humans and great apes) with the guinea pig GULO sequence of Inai, Y., Y. Ohta and M. Nishikimi. [2003]. What he found is “that over 50 percent of the mutations in the GULO pseudogene that are shared between humans and the great apes are mutational hot spots also found in guinea pigs – they exactly match the mutations that set humans and primates apart from the rat and line up independent of common ancestry.”
If you assume random mutations, then the guinea pig is more closely related to humans than it is to the rat—an obvious absurdity. Therefore, the best explanation for the shared GULO (Vitamin C Synthase) mutations between humans, great apes, and the guinea pig is not common descent, but rather non-random mutational hotspots that give the illusion of common descent when you compare only humans and great apes. But when you compare both to that of the guinea pig (relative to the rat), the illusion disappears and argues directly AGAINST neo-Darwinian common descent (that is, against Random Mutation + Natural Selection).
For a graphic demonstration of what I’m talking about, read the intro. to Table 2 and then take a close look at Table 2 itself, and what I said above should become crystal clear. You will find both on page 14 and page 16 (last 3 pages) of the following paper by Peter Borger:
http://www.iscid.org/papers/Borger_SharedMutations_061506.pdf
PS Dear Allmendream, You said that if anyone could prove that the shared mutations of the Vitamin C Synthase (GULO) gene between humans and great apes emmerged independently of common descent they would probably win the Nobel Prize. Unless you see something I don't, perhaps we should begin making arrangements to get Peter Borger's name submitted to the Nobel Selection Committee :o)
Why the silence re: the GULO pseudogene directly contradicting common descent???
In the sequence comparison over 90 base pairs (extremely small sample size but the same as Borger) there are 15 differences between the rat sequence and g-pig sequence, and the human and rat sequence differ at 21 places (rats and g-pigs closer than humans and rats). Over this 90 base pairs Humans and chimps differ at only two locations, humans and g-pigs differ at 14 locations(humans and chimps are closer than humans and g-pigs).
Of these 15 locations where the g-pig sequence differs from the rat sequence you seem to be making much of the fact that seven of them show the same base substitution in the human sequence. Eight of them do not. Neither of the two differences in human and chimp sequence seems to be a “hot spot” in relation to the g-pig or rat sequence, and of the 21 differences between human and rat sequence the g-pig sequence is only changed at 9 places, why are the other 12 “hot spots” unchanged?
This is a much more complex subject than grabbing a few 90 bp sequences and counting mutations. Some base pair substitutions are more common than others, and one must account for 3rd position wobble, silent mutations, conservative substitutions, and several other factors. But even if it was this simple, the data doesn’t indicate in any way that humans and g-pigs are more closely related than g-pigs and rats; and genomic analysis bears this out in detailed surveys of genes or pseudogenes not genes-vs-pseudogene-vs-gene. And the observation of these 7 “hot spots” doesn’t seem to bear out when doing a survey of several species.
I don’t think Borger will be collecting that Nobel prize.
This is not my field. I would have to go searching websites for information (somewhat like you have done) and would not be able, from my own knowledge, to answer any tough questions that were asked in return.
As a scientist, I try to avoid such situations. I try to stick to those fields in which I actually know something.
Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.