Free Republic
Browse · Search
Bloggers & Personal
Topics · Post Article

Full title: Antibiotics that target mitochondria effectively eradicate cancer stem cells, across multiple tumor types: Treating cancer like an infectious disease
1 posted on 02/08/2015 4:37:54 PM PST by 2ndDivisionVet
[ Post Reply | Private Reply | View Replies ]


To: 2ndDivisionVet

Thanks for posting this.


2 posted on 02/08/2015 4:42:30 PM PST by ifinnegan
[ Post Reply | Private Reply | To 1 | View Replies ]

To: 2ndDivisionVet

Wow, that would be something! Along with targeted immunotherapy, the landscape is changing. Good news.


3 posted on 02/08/2015 4:43:50 PM PST by SueRae (It isn't over. In God We Trust.)
[ Post Reply | Private Reply | To 1 | View Replies ]

To: 2ndDivisionVet

Really interesting. Glad you posted this.


4 posted on 02/08/2015 4:44:48 PM PST by dforest
[ Post Reply | Private Reply | To 1 | View Replies ]

To: 2ndDivisionVet

I read that a couple of parents doing cancer research asked their 8 y.o. daughter what they should check out and the daughter suggested antibiotics.


6 posted on 02/08/2015 4:58:45 PM PST by Blood of Tyrants (True followers of Christ emulate Christ. True followers of Mohammed emulate Mohammed.)
[ Post Reply | Private Reply | To 1 | View Replies ]

To: AngieGal

ping


7 posted on 02/08/2015 5:17:22 PM PST by PetroniusMaximus
[ Post Reply | Private Reply | To 1 | View Replies ]

To: 2ndDivisionVet

Friend of mine has an uncle in a trial in Boston.

Uncle had advanced COPD and otherwise healthy. 60-70 year old.

Stem cells were removed and instilled back in his lungs. After 5 tears on o2 he can breathe normally.

this is the future folks.


10 posted on 02/08/2015 5:50:23 PM PST by Chickensoup (Leftist totalitarian fascism is on the move.)
[ Post Reply | Private Reply | To 1 | View Replies ]

To: Shimmer1

ping.


12 posted on 02/08/2015 6:16:32 PM PST by null and void (Our goal is language that is gender-, ethnic- and age-neutral, while celebrating our diversity!)
[ Post Reply | Private Reply | To 1 | View Replies ]

To: 2ndDivisionVet
Thanks for the post. My Wife found it interesting and pointed out the different classes of antibiotics used now for cancer treatment.

Anti-tumor antibiotics

Anthracyclines


Anthracyclines are anti-tumor antibiotics that interfere with enzymes involved in DNA replication. These drugs work in all phases of the cell cycle. They are widely used for a variety of cancers. A major consideration when giving these drugs is that they can permanently damage the heart if given in high doses. For this reason, lifetime dose limits are often placed on these drugs.

Examples of anthracyclines include:
Daunorubicin
Doxorubicin (Adriamycin®)
Epirubicin
Idarubicin

Other anti-tumor antibiotics

Anti-tumor antibiotics that are not anthracyclines include:
Actinomycin-D
Bleomycin
Mitomycin-C

Mitoxantrone is an anti-tumor antibiotic that is similar to doxorubicin in many ways, including the potential for damaging the heart. This drug also acts as a topoisomerase II inhibitor (see below), and can lead to treatment-related leukemia. Mitoxantrone is used to treat prostate cancer, breast cancer, lymphoma, and leukemia.


She wondered if these treatments were the genesis of the researcher's thinking.
15 posted on 02/08/2015 7:01:09 PM PST by PA Engineer (Liberate America from the Occupation Media.)
[ Post Reply | Private Reply | To 1 | View Replies ]

To: 2ndDivisionVet

Includes pancreatic cancer - this would be a real breakthrough.....


17 posted on 02/08/2015 8:53:48 PM PST by Intolerant in NJ
[ Post Reply | Private Reply | To 1 | View Replies ]

To: 2ndDivisionVet

Interesting, if you combine this with the use of http://en.wikipedia.org/wiki/CRISPR (more on CRISP is in this very good article https://www.quantamagazine.org/20150206-crispr-dna-editor-bacteria/ and this 4 min youtube video https://www.youtube.com/watch?v=2pp17E4E-O8 )


19 posted on 02/09/2015 12:17:06 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 1 | View Replies ]

To: 2ndDivisionVet; AllAmericanGirl44; Armen Hareyan; B4Ranch; Balata; Ban Draoi Marbh Draoi; ...
CANCER WARRIORS PING

This is a ping list for cancer survivors and caregivers to share information. If you would like your name added to or removed from this ping list, please tell us in the comments section at this link (click here). (For the most updated list of names, click on the same link and go to the last comment.)

23 posted on 02/09/2015 4:17:59 PM PST by Tired of Taxes
[ Post Reply | Private Reply | To 1 | View Replies ]

Free Republic
Browse · Search
Bloggers & Personal
Topics · Post Article


FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson