Free Republic
Browse · Search
General/Chat
Topics · Post Article

Skip to comments.

Anti-aging drug extends life up to 25%, staves off frailty and disease
New Atlas ^ | JULY 18, 2024 | Bronwyn Thompson

Posted on 07/22/2024 12:00:37 PM PDT by Red Badger

click here to read article


Navigation: use the links below to view more comments.
first previous 1-2021-29 last
To: AdmSmith

If this pans out, the wealthy elites will hog it all for themselves.........


21 posted on 07/23/2024 5:24:03 AM PDT by Red Badger (Homeless veterans camp in the streets while illegals are put up in 5 Star hotels....................)
[ Post Reply | Private Reply | To 20 | View Replies]

To: Red Badger

It will not be more expensive than
https://www.fiercepharma.com/pharma/novo-nordisk-ceo-jorgensen-agrees-testify-senate-over-us-pricing-semaglutide-products

here is a patent application https://worldwide.espacenet.com/patent/search/family/073776540/publication/US2023399393A1?q=pn%3DUS2023399393A1


22 posted on 07/23/2024 6:30:38 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 21 | View Replies]

To: AdmSmith
After reading this "Emerging roles for IL-11 in inflammatory diseases" https://www.sciencedirect.com/science/article/pii/S1043466621003392?via%3Dihub
I guess that another pharmaceutical company will develop a drug against one of the inflammatory diseases that works differently, and that drug would have a side effect - increase the lifespan.
23 posted on 07/23/2024 6:41:45 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 22 | View Replies]

To: Red Badger

This is a good article “Understanding interleukin 11 as a disease gene and therapeutic target” https://portlandpress.com/biochemj/article/480/23/1987/233798/Understanding-interleukin-11-as-a-disease-gene-and


24 posted on 07/23/2024 6:52:10 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 21 | View Replies]

To: AdmSmith

I remember back in the 70’s and early 80’s ‘interleukin 2’ was supposed to be a cure for cancer..................


25 posted on 07/23/2024 7:05:49 AM PDT by Red Badger (Homeless veterans camp in the streets while illegals are put up in 5 Star hotels....................)
[ Post Reply | Private Reply | To 24 | View Replies]

To: Red Badger

Biology is tricky. IL-2 is used against melanoma https://www.curemelanoma.org/patient-eng/melanoma-treatment/immunotherapy/interleukin-2-il-2-proleukin

IL-2 can enhance the anti-tumor immune response and reduce tumor growth, as demonstrated in mouse cancer models [231]. However, the systemic administration of IL-2 is associated with adverse effects, limiting its clinical application [71]. To overcome these limitations, researchers are engineering IL-2 for improved efficacy and safety in cancer treatment.
https://molecular-cancer.biomedcentral.com/articles/10.1186/s12943-023-01826-7#Sec19

and:
IL11 was until recently accepted by the scientific community as anti-fibrotic, anti-inflammatory, and pro-regenerative; newer studies highlight that IL11 is in fact the opposite: pro-fibrotic, pro-inflammatory and anti-regenerative.

i.e. not easy.


26 posted on 07/23/2024 7:33:32 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 25 | View Replies]

To: AdmSmith

Thanks!


27 posted on 07/23/2024 2:45:34 PM PDT by SunkenCiv (Putin should skip ahead to where he kills himself in the bunker.)
[ Post Reply | Private Reply | To 20 | View Replies]

To: Red Badger
Eat Apples?
https://jn.nutrition.org/article/S0022-3166(22)00801-X/fulltext
28 posted on 07/24/2024 1:13:19 AM PDT by rmlew ("Mosques are our barracks, minarets our bayonets, domes our helmets, the believers our soldiers." )
[ Post Reply | Private Reply | To 1 | View Replies]

To: rmlew

Apples are also full of sugar.....................


29 posted on 07/24/2024 5:08:03 AM PDT by Red Badger (Homeless veterans camp in the streets while illegals are put up in 5 Star hotels....................)
[ Post Reply | Private Reply | To 28 | View Replies]


Navigation: use the links below to view more comments.
first previous 1-2021-29 last

Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.

Free Republic
Browse · Search
General/Chat
Topics · Post Article

FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson