Free Republic
Browse · Search
General/Chat
Topics · Post Article


1 posted on 05/31/2024 11:41:20 AM PDT by Red Badger
[ Post Reply | Private Reply | View Replies ]


To: SunkenCiv

Ping!...................


2 posted on 05/31/2024 11:41:44 AM PDT by Red Badger (Homeless veterans camp in the streets while illegals are put up in 5 Star hotels....................)
[ Post Reply | Private Reply | To 1 | View Replies ]

To: Red Badger

Because there’s no theory that predicts things like that.


3 posted on 05/31/2024 11:46:31 AM PDT by ifinnegan (MDemocrats kill babies and harvest their organs to sell)
[ Post Reply | Private Reply | To 1 | View Replies ]

To: Red Badger

There is ONE guy who knows and that’s God Almighty.


4 posted on 05/31/2024 12:05:55 PM PDT by JJBookman (Democrats = Party of the most stupid)
[ Post Reply | Private Reply | To 1 | View Replies ]

To: Red Badger

It has the highest intelligence of all the ferns and other than a few incidents in the Paleozoic era, has been mostly peaceful.


5 posted on 05/31/2024 12:06:01 PM PDT by Farmerbob
[ Post Reply | Private Reply | To 1 | View Replies ]

To: Red Badger

“But now researchers “know they have the ability to insert themselves in nearby genes and provide them with new functions or silence them.””

Uh oh. I have a real bad feeling about this. As if the globalist ghouls playing god don’t already have enough evil goals to tinker with....(not kidding...lol).


6 posted on 05/31/2024 12:14:25 PM PDT by Danie_2023
[ Post Reply | Private Reply | To 1 | View Replies ]

To: Red Badger

It’s just data. When they do decode it, it will read “Your time is up. Best regards, God” Bummer.


10 posted on 05/31/2024 12:31:24 PM PDT by Billthedrill
[ Post Reply | Private Reply | To 1 | View Replies ]

To: Red Badger

In their ignorance, scientists don’t have an explanation for certain DNA sequences, so they call it “junk” DNA. THEN it turns out not to be.

That’s why it’s hard to trust them when they talk about settled science.


11 posted on 05/31/2024 12:50:29 PM PDT by smokingfrog ( sleep with one eye open (<o> --- )
[ Post Reply | Private Reply | To 1 | View Replies ]

To: Red Badger

Yeah, my fern’s always bragging about it, what a pain. ;^)


15 posted on 05/31/2024 4:32:06 PM PDT by SunkenCiv (Putin should skip ahead to where he kills himself in the bunker.)
[ Post Reply | Private Reply | To 1 | View Replies ]

To: Red Badger

And to think we get excited when a chubby, drooling, human baby manages for its thumb to find its mouth:

https://www.youtube.com/watch?v=xN8c_X0LNcg&ab_channel=Learjet15


20 posted on 06/01/2024 7:04:03 AM PDT by 9YearLurker
[ Post Reply | Private Reply | To 1 | View Replies ]

To: Red Badger
Genome size diversity across eukaryotes



(A) Current distribution of genome sizes across major lineages of plants, animals, and fungi.
(B) Top 10 of the largest genome size records available in eukaryotes.

https://www.cell.com/iscience/fulltext/S2589-0042(24)01111-8


24 posted on 06/01/2024 10:24:22 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 1 | View Replies ]

Free Republic
Browse · Search
General/Chat
Topics · Post Article


FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson