Free Republic
Browse · Search
General/Chat
Topics · Post Article

To: Red Badger
Genome size diversity across eukaryotes



(A) Current distribution of genome sizes across major lineages of plants, animals, and fungi.
(B) Top 10 of the largest genome size records available in eukaryotes.

https://www.cell.com/iscience/fulltext/S2589-0042(24)01111-8


24 posted on 06/01/2024 10:24:22 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 1 | View Replies ]


To: AdmSmith

I knew that fern my wife has was controlling us!


25 posted on 06/01/2024 10:26:14 AM PDT by Reily
[ Post Reply | Private Reply | To 24 | View Replies ]

Free Republic
Browse · Search
General/Chat
Topics · Post Article


FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson