Free Republic
Browse · Search
General/Chat
Topics · Post Article

Skip to comments.

This unassuming fern has the largest known genome—and no one knows why
Science.ORG ^ | May 31, 2024 | ASHLEY STIMPSON

Posted on 05/31/2024 11:41:20 AM PDT by Red Badger

click here to read article


Navigation: use the links below to view more comments.
first previous 1-2021-26 last
To: Redcitizen

I agree, but which memory in poticular, that’s what I wonder.


21 posted on 06/01/2024 7:13:45 AM PDT by SunkenCiv (Putin should skip ahead to where he kills himself in the bunker.)
[ Post Reply | Private Reply | To 19 | View Replies]

To: SunkenCiv

You’ll have to leaf through all the memories back to the Cretaceous period.


22 posted on 06/01/2024 7:36:50 AM PDT by Redcitizen
[ Post Reply | Private Reply | To 21 | View Replies]

To: Redcitizen

Water you think I’ll find?


23 posted on 06/01/2024 8:44:04 AM PDT by SunkenCiv (Putin should skip ahead to where he kills himself in the bunker.)
[ Post Reply | Private Reply | To 22 | View Replies]

To: Red Badger
Genome size diversity across eukaryotes



(A) Current distribution of genome sizes across major lineages of plants, animals, and fungi.
(B) Top 10 of the largest genome size records available in eukaryotes.

https://www.cell.com/iscience/fulltext/S2589-0042(24)01111-8


24 posted on 06/01/2024 10:24:22 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 1 | View Replies]

To: AdmSmith

I knew that fern my wife has was controlling us!


25 posted on 06/01/2024 10:26:14 AM PDT by Reily
[ Post Reply | Private Reply | To 24 | View Replies]

To: SunkenCiv

The spoor leads to the original Fern spore.


26 posted on 06/01/2024 11:58:32 AM PDT by Redcitizen
[ Post Reply | Private Reply | To 23 | View Replies]


Navigation: use the links below to view more comments.
first previous 1-2021-26 last

Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.

Free Republic
Browse · Search
General/Chat
Topics · Post Article

FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson