AP/Bob Goldstein/Vicki Madden
1 posted on
11/25/2015 9:32:36 PM PST by
BenLurkin
To: BenLurkin
look it’s Michael Moore’s as a baby... aww how cute
2 posted on
11/25/2015 9:40:48 PM PST by
tophat9000
(King G(OP)eorge III has no idea why the Americans Patriots are in rebellion... teach him why)
To: BenLurkin
Saw this article in the news yesterday.
These creatures have Amazing survival capabilities, like no other living thing.
These Extremophiles are technically capable of living forever if allowed to go thru regular dormancy cycles.
3 posted on
11/25/2015 9:45:55 PM PST by
MarchonDC09122009
(When is our next march on DC? When have we had enough?)
To: Darksheare; BenLurkin; Salamander
And the
BLatting OG says:

"Mommy?!?"
4 posted on
11/25/2015 9:58:42 PM PST by
shibumi
(Vampire Outlaw of the Milky Way)
To: BenLurkin
5 posted on
11/25/2015 10:04:30 PM PST by
Ken H
To: BenLurkin
[[Through a process called horizontal gene transfer, any organism can theoretically swap genes with another.]]
Which only, according to my understanding, happens between the same kinds of species- not between unrelated species kinds because unrelated species kinds have several layers of protectiosn which prevent such horizontal transfers whereas related species kinds have the necessary info to receive and utilize dna from their own kind
9 posted on
11/25/2015 10:24:37 PM PST by
Bob434
To: BenLurkin
12 posted on
11/25/2015 11:07:54 PM PST by
80skid
To: BenLurkin
On the shelves in time for Christmas.
13 posted on
11/25/2015 11:34:09 PM PST by
kanawa
To: BenLurkin
I've seen pics of these little fellas before - they look like a cross between a caterpillar and an overstuffed sofa. Too bad they're so small. I bet they'd make a great domestic pet. Bet those claws would give a cat a run for it's money on the furniture, though.

15 posted on
11/26/2015 1:43:34 AM PST by
Viking2002
(The Avatar is back by popular request.)
To: BenLurkin
Those grasping claws are a dead giveaway. This is the ancestral creature from which is descended the modern Gimmedat. A clearer proof of devolution would be hard to imagine.
17 posted on
11/26/2015 3:17:06 AM PST by
sphinx
To: BenLurkin
Looks like a love seat from Ikea.
18 posted on
11/26/2015 3:35:39 AM PST by
XEHRpa
To: BenLurkin
An example of how life 1st got to earth?
30 posted on
11/26/2015 9:44:18 AM PST by
TruthWillWin
(The problem with socialism is that you eventually run out of other peoples money.)
To: BenLurkin
31 posted on
11/26/2015 2:39:18 PM PST by
backwoods-engineer
(AMERICA IS DONE! When can we start over?)
To: BenLurkin
32 posted on
11/26/2015 2:44:57 PM PST by
Joe 6-pack
(Qui me amat, amat et canem meum.)
To: BenLurkin; Salamander; SunkenCiv
42 posted on
12/06/2015 10:52:24 AM PST by
AdmSmith
(GCTGATATGTCTATGATTACTCAT)
To: BenLurkin
46 posted on
12/06/2015 12:20:33 PM PST by
JoeProBono
(SOME IMAGES MAY BE DISTURBING ’VIEWER DISCRETION IS ADVISED;-{)
To: BenLurkin
Not so tough after all.
....a living tardigrade that's not in the cryptobiotic state is actually pretty fragile.
If you stuck a living, active tardigrade directly into liquid nitrogen, boiling water, your own stomach acid, etc. etc., you'd kill it instantly.
Your own immune defenses would make short work of any tardigrade that got into your bloodstream.
Tardigrades can get attacked by viruses and bacteria and fungi and predatory nematodes, and they can be physically damaged as well.
There are lots of things that can kill them.
55 posted on
01/17/2016 9:10:22 AM PST by
Koracan
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson