Free Republic
Browse · Search
General/Chat
Topics · Post Article

To: Roos_Girl
The taste of the baking soda makes me gag, probably because I’m pregnant. So I’ve been putting a thin line of toothpaste on the brush and then piling on the baking soda, work in to one area and then repeat. The little bit of mint flavor really helps.

Congratulations on the coming baby! My elder daughter is about to have my first grandchild... so I share your excitement.

You will get used to the flavor and grow to like it, but in the meantime, that is a good approach. Just make sure you work the baking soda into the gums between your gums and teeth and also floss it in between... they like to hide there, too. DO IT for your children, so you'll be around and aware for their babies.

224 posted on 10/11/2011 11:01:34 AM PDT by Swordmaker (This tag line is a Microsoft product "insult" free zone.)
[ Post Reply | Private Reply | To 223 | View Replies ]


To: Swordmaker

Thanks! And congratulations to you!


225 posted on 10/11/2011 11:42:45 AM PDT by Roos_Girl (The world is full of educated derelicts. - Calvin Coolidge)
[ Post Reply | Private Reply | To 224 | View Replies ]

To: Swordmaker
What Causes Alzheimer’s?

Researchers and pharma companies have tried to attack this disease by reducing amyloid plaques, but inflammation may be the real culprit.

To investigate whether IL-1 might play a role in Lewy body pathology seen in Alzheimer's, we tested the role of IL-1 in alpha-synuclein fiber production using three methods: in tissue culture, in IL-1-pellet implanted rat brains, and in brain slices from Alzheimer’s patients. All three methods gave the same results, showing that IL-1 overexpression was associated with increased production of alpha-synuclein

http://the-scientist.com/2011/09/01/what-causes-alzheimers/

A nice link IL-1 and spirochetes:
Interleukin- 1 gene polymorphisms as assessed in a 10-year study of patients with early-onset periodontitis.
http://www.ncbi.nlm.nih.gov/pubmed/17575917 and

Salivary interleukin-1beta concentration and the presence of multiple pathogens in periodontitis.

http://www.ncbi.nlm.nih.gov/pubmed/19799718

226 posted on 10/19/2011 8:31:10 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 224 | View Replies ]

Free Republic
Browse · Search
General/Chat
Topics · Post Article


FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson