Free Republic
Browse · Search
Bloggers & Personal
Topics · Post Article

Skip to comments.

Attack On Europe: Documenting Russian Equipment Losses During The 2022 Russian Invasion Of Ukraine (2 year anniversary)
ORYX ^ | Since February 24, 2022 and daily | ORYX

Posted on 02/24/2024 5:59:01 AM PST by SpeedyInTexas

This list only includes destroyed vehicles and equipment of which photo or videographic evidence is available. Therefore, the amount of equipment destroyed is significantly higher than recorded here. Loitering munitions, drones used as unmanned bait, civilian vehicles and derelict equipment are not included in this list. All possible effort has gone into avoiding duplicate entries and discerning the status of equipment between captured or abandoned. Many of the entries listed as 'abandoned' will likely end up captured or destroyed. Similarly, some of the captured equipment might be destroyed if it can't be recovered. When a vehicle is captured and then lost in service with its new owners, it is only added as a loss of the original operator to avoid double listings. When the origin of a piece of equipment can't be established, it's not included in the list. The Soviet flag is used when the equipment in question was produced prior to 1991. This list is constantly updated as additional footage becomes available.

(Excerpt) Read more at oryxspioenkop.com ...


TOPICS: Military/Veterans
KEYWORDS: 0killthisthread; 1637borders; 3daywar; agitprop; alfredeblitz; americalast; angrykeywordtroll; anotherputinfail; anydaynowukrainewins; assistantdemsonfr; attackoneurope; beaubothebsartist; beauzo; bidenswar; bobomaximus; breevingroom; byepif; byespeedy; cantbreev; cheesymaximus; crazyivan; dailydeathfap; dailypropaganda; deathcult; delusionalzeepers; demyanganul; dimwit; dualcitizenssuck; escalation; fishiemaximus; foreigntrolls; foreigntrollsonfr; formersovietofficers; gabbagabbahey; ghoulishdelight; gleefulnosegold; globohomo; goodriddance; hopium; irynazarutska; itsoveriwasright; jonboy; jonboyputinlover; keiththedimwit; kievstronk; liberalatpost7819; liedaboutleaving; melon; melonballsforever; melonlovesputin; melonlovesrussia; melonmemewarrior; melonmlrs; motherpif; muscovite; nato; omgputinputinputin; oyveygoyim; paidazovfans; paidazovtrolls; paidrussiantrolls; pancakemaximus; phdft; pifpouf; pifpuffs; planetzeep; polygamy; propagandareturns; put; putin; putinsfolly; putinstarted; putinswar; russia; russiandelusions; saintvolodymyr; siloviki; slaviccivilwar; slavictrolls; snufffilmsonfr; snufffilmtx; snuffpornforzeepers; snuffyfromtexas; spammyintexas; speedomaximus; speedycameback; speedyhadenough; speedyintroll; speedyisaliveandwell; speedyisdeadandfried; speedylied; stankazzintx; stankazztexicunt; staygonethistime; stenrynning; stinkstankstunkazz; stpetersburgtrolls; talkingtomypif; tippecanoeandpiftoo; toldyouso; tothelastrussian; tothelastukrainian; ukraine; unhealthyobsession; usaidcheckbounced; usaidtrolls; vladtheimploder; warporn; wellbye; wildberry; yostanky; yurpstronk; zeepercirclejonk; zeepercreepers; zeeperdeathcult; zeeperhomeworld; zeeperloveazov; zeeperpr0n; zeepers; zeepersjustwannazeep; zeeperslovedeath; zeeperslovevindman; zeepersworshipdeath; zeepervictoryparade; zeepharder; zeepyintexas; zipadeedoodah; zot; zottedintexas; zottyintexas
Navigation: use the links below to view more comments.
first previous 1-20 ... 9,461-9,4809,481-9,5009,501-9,520 ... 20,121-20,125 next last
To: FtrPilot

Got a neighbor who could take care of them if Russia wants 😂


9,481 posted on 12/12/2024 2:26:24 PM PST by blitz128
[ Post Reply | Private Reply | To 9472 | View Replies]

To: FtrPilot

The usual is remarkably busy today, I guess spamming only works one way. Poor fella fall of Syria has taken its toll😂


9,482 posted on 12/12/2024 2:29:42 PM PST by blitz128
[ Post Reply | Private Reply | To 9472 | View Replies]

To: FtrPilot

There’s been no surge in U.S. , UK, NATO military supply deliveries to Ukraine via Poland since late November.


9,483 posted on 12/12/2024 3:45:01 PM PST by marcusmaximus
[ Post Reply | Private Reply | To 9475 | View Replies]

To: blitz128

9,484 posted on 12/12/2024 4:06:06 PM PST by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 9482 | View Replies]

Future FBI Director Kash Patel wants an investigation into where the money we sent to Ukraine went. pic.twitter.com/Nv6kg7XLmf— Insurrection Barbie (@DefiyantlyFree) December 11, 2024


9,485 posted on 12/12/2024 4:09:20 PM PST by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 9484 | View Replies]

To: JonPreston

LOL. Gaslighting in the finest Bolshevik traditions. War is peace. Defending home and hearth against a foreign invasion is “warmongering”. Nothing new under under the filth and scum of the mass murdering Moscow Kremlin sun.


9,486 posted on 12/12/2024 4:26:56 PM PST by lodi90
[ Post Reply | Private Reply | To 9480 | View Replies]

To: lodi90

9,487 posted on 12/12/2024 4:33:45 PM PST by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 9486 | View Replies]

To: gleeaikin

Russian Offensive Campaign Assessment, December 12, 2024

Russia is reportedly moving four ships from Russian ports to Syria, possibly to facilitate evacuations —further demonstrating the Kremlin’s current cautious response to the developing situation in Syria. Ukraine’s Main Military Intelligence Directorate (GUR) stated on December 12 that Russian forces from throughout Syria are withdrawing to Hmeimim Air Base and the Port of Tartus and that Russian forces are flying four to five miliary transport sorties daily between Hmeimim and unspecified airfields in Russia.[7] The GUR stated that Russia is moving its Ivan Gren Ivan Gren-class large landing ship and the Aleksandr Otrakovsky Ropucha-class landing ship to Tartus to evacuate weapons and equipment. The GUR stated that the two ships are currently in the Norwegian Sea and are scheduled to pass the English Channel in “a few days.” The GUR stated that the Russian Sparta and Sparta II cargo ships also left Baltiysk, Kaliningrad Oblast and St. Petersburg, respectively, and are heading to Tartus. It will likely be weeks until these ships reach the Mediterranean Sea and arrive at the Port of Tartus, and Russia may be moving these ships as a precaution should Moscow decide to conduct wider evacuations of the Port of Tartus and Hmeimim Air Base in the coming weeks. ISW continues to assess that the Kremlin is very likely hesitant to completely evacuate all military assets from Syria in the event that it can establish a relationship with Syrian opposition forces and the transitional government and continue to ensure the security of its basing and personnel in Syria.[8]

https://www.understandingwar.org/backgrounder/russian-offensive-campaign-assessment-december-12-2024


9,488 posted on 12/12/2024 6:43:39 PM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 9457 | View Replies]

To: BeauBo; gleeaikin; PIF; ansel12
This is a fact-check:

" 'About 1 million Ukrainian soldiers have died'
— ABC spills the beans on the Ukrainian war"

From X regarding the link:

"This video is digitally altered.
The original ABC News video, which was published in 2023 can be found below.
There is no mention of 1 million Ukrainian soldiers being killed."

Ukrainians have always insisted that the Russian-to-Ukrainian casualty ratio is about 3 to 1 and up to 6 to 1 during Russian "meat wave" assaults.

Ukrainians put Russian total casualties at circa 750,000 suggesting Ukrainian casualties in the 250,000 range and KIAs in the neighborhood of 50,000.
Others claim Ukraine's dead are closer to 100,000 -- take your pick.

9,489 posted on 12/13/2024 3:46:28 AM PST by BroJoeK (future DDG 134 -- we remember)
[ Post Reply | Private Reply | To 9464 | View Replies]

To: JonPreston

India is not breaking sanctions by buying oil, if it is under the price cap.

Those sanctions were designed to get the oil, but reduce Russia’s revenue from it. Mission accomplished.


9,490 posted on 12/13/2024 3:46:29 AM PST by BeauBo
[ Post Reply | Private Reply | To 9478 | View Replies]

To: BroJoeK

Facts don’t matter to these usuals, 1 million dead would mean 2-3 million wounded if not more and there would be no Ukrainian soldiers to stop Russian meat wave attacks, so what is stopping Russia?

They are inept, but even the worst football team can score a touchdown if there is no defense on the field.

If you really want a laugh look up Russian mod numbers for Ukrainian loses.

The numbers they claim for Ukrainian loses are literally more than the Ukrainians have ever had.

The war is closing in on three years if you start from feb22 and not 2014 and how far have they advanced? Fact is they control less land they did after the full scale invasion. And now they have lost Syria and their operations in Africa by their Africa Corp(interesting choice of name wouldn’t you say for avowed anti- Nazis).
Their “unlimited” soviet stocks of equipment and ammunition are rapidly being depleted and they are relying on men, ammunition, and equipment from China and NK. Doubt Iran will be if much help anymore.

What they do have plenty of is memes and juvenile comments from their troll army, let’s see how that works out in Kursk


9,491 posted on 12/13/2024 4:54:16 AM PST by blitz128
[ Post Reply | Private Reply | To 9489 | View Replies]

To: BeauBo
India is not breaking sanctions by buying oil

The EU is breaking their own sanctions by buying Russian oil from India, you ditz


9,492 posted on 12/13/2024 4:59:26 AM PST by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 9490 | View Replies]

To: JonPreston
Good morning thread.

Please join me in bringing truth and reality to the many propagandized Neocons who walk among us.


9,493 posted on 12/13/2024 5:09:26 AM PST by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 9492 | View Replies]

To: marcusmaximus

There’s been no surge in U.S. , UK, NATO military supply deliveries to Ukraine via Poland since late November.


so claimed US surge stuff is once again ‘stuck’ in the ‘pipeline’?


9,494 posted on 12/13/2024 5:19:22 AM PST by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 9483 | View Replies]

To: lodi90

9,495 posted on 12/13/2024 5:20:48 AM PST by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 9486 | View Replies]

To: BeauBo

Reporting From Ukraine:
https://www.youtube.com/@RFU/videos

Reporting From Ukraine Uncensored Combat Footage (from this and past Reports) is found on Telegram:
https://t.me/RFUEnglish or @RFUEnglish
[ You need to have the Telegram app to view the larger videos. ]

The complete transcript.

[ Footage: Drones With Guns Hunt Russian Helicopters ]


Today [ Dec 12, 9 pm ], there are a lot of updates from Crimea.

Here, Ukrainian forces successfully misled the Russians to anticipate a missile strike on the mainland, before targeting them in a surprise attack with their latest development in the field of naval drones.

This daring attack with new features, including FPV drones and machine guns on board, not only caused significant damage, but also showcased the further evolution of Ukrainian military capabilities.

As a preparation for their main strike, the Ukrainians launched a misleading operation in the days before. They targeted several Russian air defense assets throughout Crimea, including a Podlyot mobile radar system in the northwestern part of the peninsula and an S-400 air defense system near Simferopol. This activity led the Russians to expect an imminent attack from the air, diverting their attention from the sea.

Then a Russian military analyst broke the news about a Ukrainian raid in the Black Sea by claiming that the gas platforms used as visual and radar observation points by the Russians had been attacked.

He sounded the alarm that the Ukrainian forces have not only used traditional naval drones in this attack, but also modernized versions able to carry FPV drones on board that can independently strike targets. He also claimed that some of the Ukrainian naval drones mysteriously disappeared during the overnight strike, indicating possible new operational capabilities.

More information became available when later the Security Service of Ukraine published geolocated footage showing Ukrainian naval drones destroying Russian surveillance systems on gas platforms off the west coast of Crimea in the Black Sea. This is a repeated strike against these platforms, as Russians not only use these platforms for surveillance, but also for launching various missiles against Ukrainian cities and military targets.

To understand how important this development is, we need to look at the tactical evolution of the Sea Baby drones. Previously, the biggest vulnerability of these Ukrainian naval assets was their inability to defend against helicopters, which could easily detect and destroy them as the sea drones could only attempt to evade their fire.

With the addition of large-caliber 12.7mm machine guns integrated with advanced ballistic targeting systems that can auto-lock on incoming threats, Sea Baby drones can now actively engage even formidable opponents, like heavily armed helicopters.

The shocking footage from the Ukrainian Navy from this recent operation proves how the drones successfully fended off Russian helicopters and patrol boats, firing against them as soon as they were in range, reportedly inflicting significant damage and casualties among the Russian soldiers.

Their ability to return fire disrupted interception attempts, making it harder for Russian forces to neutralize them, and even gave them time to disappear safely back into the open sea and return to their bases, which instilled additional shock into the involved Russian personnel.

The recent upgrades demonstrate a significant leap in their tactical and technological capabilities, transforming them from simple explosive-laden vessels into versatile combat platforms.

Through this development, Sea Baby drones can now leverage their multi-role capabilities for maximum tactical advantage. Beyond their enhanced firepower, these drones are also used as platforms for smaller FPV drones, which can independently strike targets such as coastal defense systems, patrol boats, and helicopters, if they stray too close or gather reconnaissance data.

This dual-layered approach allows Ukrainian forces to execute precision strikes while simultaneously defending the naval drones against air and surface threats. For example, this was also confirmed during the latest raid, as carried FPV drones enabled the coordinated assault and effective post-strike monitoring.

Overall, the Sea Baby’s evolution showcases Ukraine’s adaptive and innovative approach to modern warfare. By addressing critical vulnerabilities, integrating new capabilities, and repeatedly targeting high-value assets such as the Crimean Bridge and Russian naval infrastructure. These drones continue to shift the balance in contested areas like the Black Sea, presenting a robust response to Russia’s military presence.

The new sea drones are not only tools for direct strikes, but also function as platforms for psychological and operational leverage, being able to conduct hit-and-run strikes against long-distance targets on the open seas.


9,496 posted on 12/13/2024 5:31:30 AM PST by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 9490 | View Replies]

To: PIF

Finally a transport flight from Canada today. Just one. Not a surge.


9,497 posted on 12/13/2024 5:41:32 AM PST by marcusmaximus
[ Post Reply | Private Reply | To 9494 | View Replies]

To: BeauBo; gleeaikin; PIF; ansel12

Trump wearing blue & gold, met Macron & Zelensky, December 7, 2024:

Fact check:

"It's OVER
Thank you President Trump

🚨Update: 'I am against strikes on Russia with American long-range missiles, it only escalates the situation!'

— President Trump pic.twitter.com/RTNS42pj0j— US Civil Defense News (@CaptCoronado) December 12, 2024"

The original quote is from Trump's November 25 interview with Time magazine, and it followed Pres. Biden's November 17 authorization for Ukrainians to use longer range US missiles to strike deeper within Russia.

Ukraine long-range strikes into Russia using US supplied missile began on November 19, against ammunition storage sites in Bryansk Oblast, and continue on November 25 with a Russian and North Korean headquarters in Kursk Oblast, now most recently on December 11, a Russian military air base in Taganrog, in the southern Rostov region.

On December 7, Ukraine's Pres. Zelensky met in Paris with Trump and French Pres. Macron -- afterwards Zelensky expressed his support for Trump's "strong resolve" to end the war, however, nothing was said about ending Ukraine's missile strikes into Russia.

BTW, this is Ukraine's previous president, and likely challenger to Zelensky in elections after the war is over, Petro Poroshenko.
To me his language sounds just as strong as Zelensky's, if not stronger.

Trump with Poroshenko, June 2017:

9,498 posted on 12/13/2024 5:42:29 AM PST by BroJoeK (future DDG 134 -- we remember)
[ Post Reply | Private Reply | To 9467 | View Replies]

To: blitz128
"Facts don’t matter to these usuals..."

Agreed, big time.

"And now they have lost Syria and their operations in Africa by their Africa Corp(interesting choice of name wouldn’t you say for avowed anti- Nazis)."

Yes, perhaps as surprising, but also understandable, as the US 1998 Operation Desert Fox in Iraq.

Military men everywhere can recognize Romel as being highly capable, decent and non-political.

9,499 posted on 12/13/2024 5:56:01 AM PST by BroJoeK (future DDG 134 -- we remember)
[ Post Reply | Private Reply | To 9491 | View Replies]

To: JonPreston
LOL!
The little turd will be joining shortly.

1-JS259041968
9,500 posted on 12/13/2024 5:58:51 AM PST by ANKE69 (✌️🇺🇲 Let's MAGA)
[ Post Reply | Private Reply | To 9493 | View Replies]


Navigation: use the links below to view more comments.
first previous 1-20 ... 9,461-9,4809,481-9,5009,501-9,520 ... 20,121-20,125 next last

Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.

Free Republic
Browse · Search
Bloggers & Personal
Topics · Post Article

FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson