Free Republic
Browse · Search
Bloggers & Personal
Topics · Post Article

Skip to comments.

Attack On Europe: Documenting Russian Equipment Losses During The 2022 Russian Invasion Of Ukraine (2 year anniversary)
ORYX ^ | Since February 24, 2022 and daily | ORYX

Posted on 02/24/2024 5:59:01 AM PST by SpeedyInTexas

This list only includes destroyed vehicles and equipment of which photo or videographic evidence is available. Therefore, the amount of equipment destroyed is significantly higher than recorded here. Loitering munitions, drones used as unmanned bait, civilian vehicles and derelict equipment are not included in this list. All possible effort has gone into avoiding duplicate entries and discerning the status of equipment between captured or abandoned. Many of the entries listed as 'abandoned' will likely end up captured or destroyed. Similarly, some of the captured equipment might be destroyed if it can't be recovered. When a vehicle is captured and then lost in service with its new owners, it is only added as a loss of the original operator to avoid double listings. When the origin of a piece of equipment can't be established, it's not included in the list. The Soviet flag is used when the equipment in question was produced prior to 1991. This list is constantly updated as additional footage becomes available.

(Excerpt) Read more at oryxspioenkop.com ...


TOPICS: Military/Veterans
KEYWORDS: 0killthisthread; 1637borders; 3daywar; agitprop; alfredeblitz; americalast; angrykeywordtroll; anotherputinfail; anydaynowukrainewins; assistantdemsonfr; attackoneurope; beaubothebsartist; beauzo; bidenswar; bobomaximus; breevingroom; byepif; byespeedy; cantbreev; cheesymaximus; crazyivan; dailydeathfap; dailypropaganda; deadthread; deathcult; deepinthespamforest; delusionalzeepers; demyanganul; dimwit; dualcitizenssuck; escalation; fishiemaximus; foreigntrolls; foreigntrollsonfr; formersovietofficers; freeploader; freeploadingspammer; gabbagabbahey; ghoulishdelight; gleefulnosegold; globohomo; goodriddance; hopium; irynazarutska; itsoveriwasright; jonboy; jonboyputinlover; keiththedimwit; kievstronk; liberalatpost7819; liedaboutleaving; melon; melonballsforever; melonlovesputin; melonlovesrussia; melonmemewarrior; melonmlrs; motherpif; muscovite; nato; omgputinputinputin; oyveygoyim; paidazovfans; paidazovtrolls; paidrussiantrolls; pancakemaximus; phdft; pifpouf; pifpuffs; planetzeep; polygamy; propagandareturns; put; putin; putinsfolly; putinstarted; putinswar; russia; russiandelusions; saintvolodymyr; siloviki; slaviccivilwar; slavictrolls; snufffilmsonfr; snufffilmtx; snuffpornforzeepers; snuffyfromtexas; spammyintexas; speedomaximus; speedycameback; speedyhadenough; speedyintroll; speedyisaliveandwell; speedyisdeadandfried; speedylied; stankazzintx; stankazztexicunt; staygonethistime; stenrynning; stinkstankstunkazz; stpetersburgtrolls; talkingtomypif; thisthreadisdead; tippecanoeandpiftoo; toldyouso; tothelastrussian; tothelastukrainian; ukraine; unhealthyobsession; usaidcheckbounced; usaidtrolls; vladtheimploder; warporn; wellbye; wildberry; yostanky; yurpstronk; zeepercirclejonk; zeepercreepers; zeeperdeathcult; zeeperhomeworld; zeeperloveazov; zeeperpr0n; zeepers; zeepersjustwannazeep; zeeperslovedeath; zeeperslovevindman; zeepersworshipdeath; zeepervictoryparade; zeepharder; zeepyintexas; zipadeedoodah; zot; zottedintexas; zottyintexas
Navigation: use the links below to view more comments.
first previous 1-20 ... 8,061-8,0808,081-8,1008,101-8,120 ... 20,501-20,518 next last
To: neocon; oof

8,081 posted on 11/08/2024 11:49:49 AM PST by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 8077 | View Replies]

To: JonPreston

Zelensky doesn’t have a choice, he’s a bought and paid for puppet.


8,082 posted on 11/08/2024 11:51:42 AM PST by 1Old Pro
[ Post Reply | Private Reply | To 8081 | View Replies]

To: JonPreston
Z, Z, Z....


8,083 posted on 11/08/2024 11:54:37 AM PST by Frank Drebin (And don't ever let me catch you guys in America!)
[ Post Reply | Private Reply | To 8081 | View Replies]

🚨BREAKING: Donald Trump and Elon Musk informed Zelenskyy that the war is over and urged him to prepare for negotiations. They also stated that no additional funds or weapons will be sent to Ukraine.

Game over.— Jack (@jackunheard) November 8, 2024


8,084 posted on 11/08/2024 12:07:17 PM PST by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 8083 | View Replies]

🚨Update:

Russia no longer recognizes Zelensky as the president of Ukraine!

Zelensky now wanted by Russia for war crimes!!

He is a legitimate target now!!

pic.twitter.com/gDM3P8dtSG— US Civil Defense News (@CaptCoronado) November 8, 2024


8,085 posted on 11/08/2024 12:10:53 PM PST by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 8084 | View Replies]

To: FtrPilot

Kremlin snuff box, 11/07/24
https://t.me/s/kremlin_secrets

“Trump needs to understand.” Putin gave important signals about the Northern Military District and the fight against NATO, but disappointed some influential people

We spoke with several high-ranking sources about the signals Vladimir Putin gave to Russia and the world during his speech at the Valdai Discussion Club meeting [ https://t.me/ejdayru/13645 ]. It should be noted that the opinions of our interlocutors differed.

A source in the Kremlin believes that the President gave a powerful signal to the Americans.

“Trump must understand that the United States can no longer be the most important country in the world. That there is also us, our same Chinese partners. We hope that he will hear Vladimir Vladimirovich and recognize Russia as an equal state to America. If not, it will be his big mistake,” he said.

This point of view is supported by several other interlocutors. True, many of them remain skeptical that the change of power in the United States will lead to the imminent completion of the SVO.

“We will be fighting for a long time, I have no doubt,” said a representative of the Ministry of Defense. We wrote earlier [ https://t.me/kremlin_secrets/4871 ] about the existence of such skepticism among our elites about the imminent end of hostilities .

However, not everyone was pleased with Putin’s speech.

“Vladimir Vladimirovich’s advisers, who helped him prepare his speech, made a mistake and must be punished. Judge for yourself: the President actually directly said that we are afraid of Western nuclear weapons [https://t.me/rian_ru/268036 ]. And he admitted [ https://t.me/rian_ru/268042 ] that we feel humiliated because of the Americans. These are things that don’t need to be said to the whole world. It’s wrong,” says a source in the Ministry of Defense.

Another senior military official noted: “We certainly have concerns about war with NATO. God forbid it starts. But the West should fear us. Why should we be afraid if Russia admits: we have been humiliated? It didn’t turn out very convenient.”

In general, opinions about Vladimir Vladimirovich’s speech were divided. For example, many praised him for congratulating Trump on his election victory [ https://t.me/smotri_media/96493 ]. But some people think it shouldn’t have been done. Just like you shouldn’t be the first to call the elected President of the United States.

Let’s say something important. Everyone knows how much we respect our President. How we support the Northern Military District, as well as plans for the liquidation of the so-called Ukraine. But as honest people, two difficult questions must be asked.

First of all, Vladimir Vladimirovich! How can we win the SVO, if most of society doesn’t care? Many people don’t even remember that we are at war. This problem must be solved immediately, the whole people must fight for Victory! Everyone should remember the war, feel that it is going on! And we’re not the only ones who think so [https://t.me/kremlin_secrets/4814 ].

Secondly, how to win in the Northern Military District and how to effectively fight NATO, if we have so many problems in command and control? We write about a small part of them because we have a responsibility to talk about these problems. Let us remind you that recently the brother of one of our administrators died at the front due to command errors [https://t.me/kremlin_secrets/4845 ]. We are looking forward to solutions to restore order!


8,086 posted on 11/08/2024 12:11:35 PM PST by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 8073 | View Replies]

To: JonPreston

JUST IN: Elon Musk on Ukraine-Russia war:

"The senseless k*lling will end soon. Time is up for the warmonger profiteers." pic.twitter.com/6cYRFQ30o0— BRICS News (@BRICSinfo) November 8, 2024


8,087 posted on 11/08/2024 12:15:52 PM PST by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 8085 | View Replies]

To: PIF
The Ukrainian company 3DTech is preparing to deliver the first batch of FPV drones controlled by fiber optic cable to the Ukrainian military. These drones are immune to radio-electronic interference, making them highly effective on the battlefield.

https://x.com/NOELreports/status/1854867609201553694


8,088 posted on 11/08/2024 12:24:22 PM PST by FtrPilot
[ Post Reply | Private Reply | To 8086 | View Replies]

To: PIF
🔥The 🇺🇦 Ukrainian Incognito Group, 54th Mechanised Brigade destroys RuZZian invaders with 🇺🇸American M67 grenade in the Donetsk region.

Instead of surrendering, the 🇷🇺 Russian invader made a "better" choice...

148th case of… 3rd in a day

https://x.com/GloOouD/status/1854937473828229592


8,089 posted on 11/08/2024 12:27:59 PM PST by FtrPilot
[ Post Reply | Private Reply | To 8088 | View Replies]

To: BeauBo
UKRAINE’S R2-120 ‘RAIJIN’: With a 45-minute mission endurance, the Raijin loitering munition can cruise at 110 Km/ph (68 mph) and can 'sprint to target' at speeds of up to 270 km/h (167 mph).

https://x.com/ChuckPfarrer/status/1854972991903613051


8,090 posted on 11/08/2024 12:31:22 PM PST by FtrPilot
[ Post Reply | Private Reply | To 8089 | View Replies]

To: Frank Drebin

Ah so Russia declares something and it is so

That is so cute


8,091 posted on 11/08/2024 3:50:17 PM PST by blitz128
[ Post Reply | Private Reply | To 8083 | View Replies]


8,092 posted on 11/09/2024 2:14:07 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 7945 | View Replies]

To: gleeaikin; SpeedyInTexas; PIF
1.15 Russian losses/minute. How many Norks?


8,093 posted on 11/09/2024 2:22:56 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 8070 | View Replies]

To: SpeedyInTexas

When I look at Russian losses during WW II and compare it to German losses on their front and you will see that Russia is able to sustain over 3 to 4x the casulty rate of opposing forces and still win. So unless Ukrainian losses are less than 1/4th these, they are in trouble. Or am I mising something here?


8,094 posted on 11/09/2024 2:30:44 AM PST by TECTopcat
[ Post Reply | Private Reply | To 1 | View Replies]

To: FtrPilot; SpeedyInTexas; gleeaikin; PIF; blitz128; BeauBo; USA-FRANCE; BroJoeK; AmericanInTokyo
A Russian warship evacuated a senior Iranian IRGC Quds Force commander Brigadier General Abdolreza Shahlai from Hudaydah, Yemen, on an unspecified date in April 2024

Russia Is Running an Undeclared War on Western Shipping
Supplying the Houthis with targeting data crosses every red line of maritime law.

One of the U.N. Security Council's five permanent members is actively supporting attacks on global shipping. It's a stark violation of the maritime rules, which grant merchant vessels the freedom and right to sail not only on the high seas but also through other countries’ waters and through internationally recognized straits without having to fear, let alone experience, acts of aggression.

The fact that Russia is giving the Houthis specific information about vessels’ exact presence in the Red Sea is making this strategic waterway even more dangerous for Western-linked ships. “If you're a Western-linked merchant ship traveling through the Red Sea with whatever naval escort is available, you'll not be signaling your position by using AIS [automatic identification systems, a maritime GPS],” said Nils Christian Wang, a retired rear admiral and former chief of the Danish Navy. “That means the Houthis would struggle to know what ships are arriving and where they are, so this data would be extremely useful.” (Western naval forces in the Red Sea escort vessels regardless of their flag registration and country of ownership.)

Russia's provision of targeting data may be followed by yet more support for the Houthis. According to Disruptive Industries (DI), a U.K. technology company that specializes in the closed-source discovery of global risks, there is extensive and unseen Russian activity in Houthi-held parts of Yemen, and there has been for some time.

For now, the continuing strikes against Western vessels present a massive risk for Western-linked merchant vessels in the Red Sea and the Western naval vessels that are there to protect shipping. And the discovery that Russia is providing targeting data could convince the few remaining Western shipping lines still sending vessels through the Red Sea to give up on it (and the Suez Canal) altogether. One of the oldest routes of modern shipping could be abandoned—until Russia and the Houthis are bought to heel.

https://foreignpolicy.com/2024/11/07/russia-houthis-targeting-data-war-western-shipping-gaza/

During the Cold War, we used to say that the Soviet Union was responsible for 80% of all conflicts in the world, this dropped to single digits in the early 90s. Now it has risen to almost 90%. We must put a stop to this.

8,095 posted on 11/09/2024 3:19:23 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 7771 | View Replies]

To: FtrPilot

North Korea’s Wacky Type 73 Machine Guns May Be Entering The Fight In Ukraine
North Korea’s Type 73s are a unique mashup of Soviet and Czech machine gun designs that are rare to see outside of the Hermit Kingdom
https://www.twz.com/news-features/north-koreas-wacky-type-73-machine-guns-may-be-entering-the-fight-in-ukraine


U.S. Contractors Will Be Allowed To Fix F-16s, Patriots In Ukraine: Report
Allowing U.S. personnel to work on donated equipment in Ukraine represents a major policy shift by the outgoing Biden administration.
https://www.twz.com/air/u-s-contractors-will-be-allowed-to-fix-f-16s-patriots-in-ukraine-report


Russia’s S-70 Hunter Flying Wing Drone Downed In Ukraine Packed With Western Components
The discovery of dozens of Western components on the S-70 highlights the challenges of keeping these items out of Russian hands.
https://www.twz.com/news-features/russias-s-70-hunter-flying-wing-drone-downed-in-ukraine-packed-with-western-components


8,096 posted on 11/09/2024 4:27:12 AM PST by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 8090 | View Replies]

To: TECTopcat

Here is my non expert opinion on your question.

Comparing the Soviet Union of Ww2 to Russia and the “SMO” is not an apples to apples comparison for many reasons.

The size of the war is not the same for starters. May seem obvious but it does matter. The Soviet Union was fully mobilized and the entire state was involved in one thing to win the war. What does that mean?

To begin with the population was larger and the military forces were larger, but so was its opponent.
The industrial output for the war machine was also vastly larger producing huge amounts of ammunition and equipment, but additionally so was the assistance they were getting from the west, primarily the US in the form of food, fuel, aircraft, ammunition, vehicles esp trucks, and even such things as wood. Support they don’t have even with the help of Iran, China, and NK.

The scope of the war means they don’t need as much support, but the fact that the support is less, their production capabilities are far less, and their population is far less still does matter.

The fact that there has not been a general mobilization is more political than because of need. Russia has a manpower problem, not necessarily because they don’t have the raw numbers to supply the “SMO”, but because politically drawing from Moscow and St. Petersburg western ethnic Russians would have political consequences. Russia has been drawing from eastern provinces and from foreign sources to feed the meat wave and that is becoming more difficult and expensive as time goes by, and at least the eastern sources and prison populations are drying up.

Secondly equipment resources are also drying up. Present day Russia does not have the production capabilities to replace loses. To this point they have been able to draw on vast stockpiles of Soviet legacy equipment, but those resources are not infinite as was claimed at the beginning and signs point to those stockpiles reaching their end.
We see more and more assaults made up of motorcycles, arcs, golf carts, and civilian vehicles which are not optimal.

Also let’s compare territorial gains from WW2 to the present. Russia is making gains, but the size of those gains relative to loses are not good.

Think of this the war between the Soviet Union and nazi germany began in June of 41 and ended may of 45. Not quite 4 years and this war as far as SMO is concerned is closing on 3 years and the Russians control less land than they did after their initial successes. Their gains are in terms of kilometers not hundreds of kilometers and their stockpiles of weapons and trained military are vastly depleted.

Not sure I answered your question, but will conclude with the stance I have held since shortly after this war began
As long a Putin is willing to sacrifice blood and treasure for his SMO and the west continues to put restrictions on the use of weapons Ukraine will never be able to regain its lost territory. Only a change in policies, supplies(like Taurus, more tanks and AFVs..), and political pressures which causes a political change in Russia can accomplish that.

Russia and Putin being able to retain even an inch of illegally attained territory will have long term ramifications. We will see


8,097 posted on 11/09/2024 4:27:46 AM PST by blitz128
[ Post Reply | Private Reply | To 8094 | View Replies]

To: FtrPilot

Reporting From Ukraine:
https://www.youtube.com/@RFU/videos

Reporting From Ukraine Uncensored Combat Footage (from this and past Reports) is found on Telegram:
https://t.me/RFUEnglish or @RFUEnglish
[ You need to have the Telegram app to view the larger videos. ]

The complete transcript.

[ Defenses Spread Thin. Ukrainians Pierce Through The Flank ]


Today [ Nov 09 ], there are a lot of interesting updates from the Toretsk direction.

Here, after months of intense fighting, the Russians halted their assaults to reorganize and rest their forces from intense fighting that brought little to negative territorial gains. This came in time as Ukrainians deployed additional reinforcements to the Toretsk area, exploiting a window of opportunity for significant counterattacks on Russian flanks.

Earlier, Russian forces lost key positions in Toretsk’s central high-rise area, prompting them to halt offensive actions and shift their focus to defense. However, the Russian command struggled to establish a defensive line in time, as their troops needed to regroup and recover, before resuming any operations.

This situation compelled Russian command to prioritize deploying their remaining combat-ready forces to the most intense battle zones, specifically Toretsk’s central high-rises and the Zabalka district to the south.

While this decision helped preserve Russian positions in these critical areas, it left gaps in the defenses of regions with lower recent activity. In Druzhba, where only skirmishes between reconnaissance groups had occurred, only a small Russian infantry group remained as most forces were concentrated in Toretsk’s key zones. Druzhba holds significant tactical value, offering Russians a potential staging ground for encircling Toretsk.

The dense tree lines near an elevated railway embankment provide an effective route to bypass Ukrainian defenses and threaten a semi-encirclement from the north. Recognizing this, Ukrainian forces decided to exploit the weakened Russian defenses in Druzhba.

Before launching a decisive assault, Ukrainian forces deployed a large number of specialized drones modified for bombing attacks. Combat footage shows Ukrainian drone operators using heavy hexacopters to drop TM-62 anti-tank mines on Russian positions in Druzhba. These mines, carried by hexacopters, proved highly effective for destroying fortified positions, such as houses used by Russian troops.

This tactic succeeded in demolishing most structures in Druzhba, forcing the Russians to rely on improvised defenses around a few trenches. Simultaneously, Ukrainian operators used regular drones to drop smaller high-explosive grenades on exposed Russian fighters in the ruined houses, finishing off any remaining resistance. These coordinated strikes overwhelmed the unprepared Russian garrison, inflicting severe losses.

With Russian positions severely weakened, Ukrainian forces launched a night assault to retake the northern part of Druzhba. Using the cover of darkness and dense tree lines, Ukrainian stormtroopers moved undetected, making this an ideal avenue for attack. Concealed in the tree lines, the Ukrainian forces surprised the outnumbered Russian defenders, who could not spot them until they entered the town.

The Russians, stationed in residential houses, already devastated by Ukrainian artillery and drone strikes, had no solid positions for defense. Under the intensity of the Ukrainian counterattack and with insufficient defenses, Russian forces were forced to withdraw. This allowed the Ukrainians to successfully recapture the northern part of Druzhba, creating a new axis of advance to strain Russian reserves further.

Overall, the extension of Russian forces and their shortage of combat-ready troops led to the expansion of Ukrainian counterattacks and their territorial gains at the weakest points of Russian defense.

These Ukrainian gains forced the Russians to deploy additional reserves to this section of the front, which is further stretching their defense thin. Reinforced pressure, in tactically important Druzhba, will fix a considerable number of Russian forces, which will make them lose additional positions in Toretsk, as they can’t effectively defend this entire section of the frontline.


8,098 posted on 11/09/2024 4:35:50 AM PST by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 8090 | View Replies]

To: PIF
🔥😳 Soldiers of SBU hit 16 Russian "Grads" in two weeks!

https://x.com/Maks_NAFO_FELLA/status/1855195165725532236


8,099 posted on 11/09/2024 6:16:01 AM PST by FtrPilot
[ Post Reply | Private Reply | To 8098 | View Replies]

To: PIF; AdmSmith
Russian media reports that 10 Ukrainian drones attacked the Aleksinsky chemical plant in the Tula region.

1 drone was shot down, 8 fell on the plant's territory, and 1 on the Aleksinskaya TPP.

Several buildings and 3 nearby houses were reportedly damaged.

https://x.com/NOELreports/status/1855187788422881501


8,100 posted on 11/09/2024 6:20:30 AM PST by FtrPilot
[ Post Reply | Private Reply | To 8099 | View Replies]


Navigation: use the links below to view more comments.
first previous 1-20 ... 8,061-8,0808,081-8,1008,101-8,120 ... 20,501-20,518 next last

Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.

Free Republic
Browse · Search
Bloggers & Personal
Topics · Post Article

FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson