Free Republic
Browse · Search
Bloggers & Personal
Topics · Post Article

Skip to comments.

Attack On Europe: Documenting Russian Equipment Losses During The 2022 Russian Invasion Of Ukraine (2 year anniversary)
ORYX ^ | Since February 24, 2022 and daily | ORYX

Posted on 02/24/2024 5:59:01 AM PST by SpeedyInTexas

This list only includes destroyed vehicles and equipment of which photo or videographic evidence is available. Therefore, the amount of equipment destroyed is significantly higher than recorded here. Loitering munitions, drones used as unmanned bait, civilian vehicles and derelict equipment are not included in this list. All possible effort has gone into avoiding duplicate entries and discerning the status of equipment between captured or abandoned. Many of the entries listed as 'abandoned' will likely end up captured or destroyed. Similarly, some of the captured equipment might be destroyed if it can't be recovered. When a vehicle is captured and then lost in service with its new owners, it is only added as a loss of the original operator to avoid double listings. When the origin of a piece of equipment can't be established, it's not included in the list. The Soviet flag is used when the equipment in question was produced prior to 1991. This list is constantly updated as additional footage becomes available.

(Excerpt) Read more at oryxspioenkop.com ...


TOPICS: Military/Veterans
KEYWORDS: 0killthisthread; 0putinsfolly; 0putinswar; 1637borders; 3daywar; agitprop; alfredeblitz; americalast; angrykeywordtroll; anotherputinfail; anydaynow; anydaynowputinwins; anydaynowrussiawins; anydaynowukrainewins; assistantdemsonfr; attackoneurope; beaubothebsartist; beauzo; bidenswar; bobomaximus; breevingroom; byepif; byespeedy; cantbreev; cheesymaximus; crazyivan; dailydeathfap; dailypropaganda; deadthread; deathcult; deepinthespamforest; delusionalzeepers; demyanganul; dimwit; dippythemelon; dualcitizenssuck; escalation; fishiemaximus; foreigntrolls; foreigntrollsonfr; formersovietofficers; freeploader; freeploadingspammer; gabbagabbahey; ghoulishdelight; gleefulnosegold; globohomo; goodriddance; hopium; irynazarutska; itsoveriwasright; jonboy; jonboyputinlover; jonputinbot; keiththedimwit; kievstronk; liberalatpost7819; liedaboutleaving; melon; melonballsforever; melonlovesputin; melonlovesrussia; melonmemewarrior; melonmlrs; motherpif; muscovite; nato; omgputinputinputin; oyveygoyim; paidazovfans; paidazovtrolls; paidrussiantrolls; pancakemaximus; phdft; pifpouf; pifpuffs; planetzeep; polygamy; propagandareturns; put; putin; putinsfolly; putinstarted; putinswar; russia; russiandelusions; saintvolodymyr; siloviki; slaviccivilwar; slavictrolls; snufffilmsonfr; snufffilmtx; snuffpornforzeepers; snuffyfromtexas; spammyintexas; speedomaximus; speedycameback; speedyhadenough; speedyintroll; speedyisaliveandwell; speedyisdeadandfried; speedylied; stankazzintx; stankazztexicunt; staygonethistime; stenrynning; stinkstankstunkazz; stpetersburgtrolls; talkingtomypif; thisthreadisdead; tippecanoeandpiftoo; toldyouso; tothelastrussian; tothelastukrainian; ukraine; unhealthyobsession; usaidcheckbounced; usaidtrolls; vladtheimploder; warporn; wellbye; wildberry; yostanky; yurpstronk; zeepercirclejonk; zeepercreepers; zeeperdeathcult; zeeperhomeworld; zeeperloveazov; zeeperpr0n; zeepers; zeepersjustwannazeep; zeeperslovedeath; zeeperslovevindman; zeepersworshipdeath; zeepervictoryparade; zeepharder; zeeploaders; zeepyintexas; zipadeedoodah; zot; zottedintexas; zottyintexas
Navigation: use the links below to view more comments.
first previous 1-20 ... 8,041-8,0608,061-8,0808,081-8,100 ... 22,221-22,224 next last

8,061 posted on 11/07/2024 3:57:53 PM PST by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 8057 | View Replies]

To: gleeaikin
🔥The 🇺🇦 Ukrainian «Peaky Blinders» unit accurately struck 🇷🇺 Russian invaders who were trying to bring in ammunition and supplies in the Pokrovsk direction.

1 drop and 4 WIA invaders, which will later become KIA

https://x.com/GloOouD/status/1854544117985861837


8,062 posted on 11/07/2024 3:58:54 PM PST by FtrPilot
[ Post Reply | Private Reply | To 8060 | View Replies]

To: marcusmaximus

Remember what Tucker Carlson told Joe Rogan about Mike Pompeo?

pic.twitter.com/oQD0zbO32t— An0maly (@LegendaryEnergy) November 7, 2024


8,063 posted on 11/07/2024 4:26:46 PM PST by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 7999 | View Replies]

To: JonPreston

Gut gemacht, Herr Drecksack Bundeskanzler Scholz.
😤😡😡😡


8,064 posted on 11/07/2024 4:41:02 PM PST by ANKE69 (✌️🇺🇲 Let's MAGA)
[ Post Reply | Private Reply | To 8056 | View Replies]

To: ANKE69

Dirtbag indeed!!


8,065 posted on 11/07/2024 4:44:12 PM PST by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 8064 | View Replies]

To: FtrPilot

I have been wondering if this was beginning to happen. Limited airframes means lots of hours on airframes. Can’t imagine mechanics and technicians have been drafted to feed the meat waves as well

When I worked Kc-135s we spent many times the amount of maintenance hours on our airframes compared to commercial aircraft, but we could

Seriously doubt that infrastructure exists in Russia


8,066 posted on 11/07/2024 5:36:29 PM PST by blitz128
[ Post Reply | Private Reply | To 8058 | View Replies]

To: blitz128; FtrPilot

Actually there have been reports of mechanics, drone managers, and other useful trained people being sent on meat waves by drunk angry officers for disagreements. This has been reported by Russian milbloggers as stupid behavior that Putin needs to know about and stop.


8,067 posted on 11/07/2024 11:37:49 PM PST by gleeaikin ( Question authority as you provide links)
[ Post Reply | Private Reply | To 8066 | View Replies]

Russian Offensive Campaign Assessment, November 7, 2024

Ukrainian strikes on Russia and Western sanctions are reportedly disrupting Russia's energy industry. The Ukrainian Foreign Intelligence Service reported on November 6 that Russian authorities partially halted operations of Russia's Volgograd; Ilsky, Krasnodar Krai; and Yaisky, Kemerovo Oblast oil refineries in October 2024 due to failure to complete scheduled repairs of damage caused by Ukrainian strikes.[12] The Ukrainian Foreign Intelligence Service stated that the shutdowns will reduce domestic Russian refining capacity, hinder exports, worsen fuel supply issues in Russia, and raise maintenance and modernization costs. The Ukrainian Foreign Intelligence Service noted that Russian authorities could not complete the repairs because they lacked the necessary Western equipment and components as a result of Western sanctions and failed import substitution efforts. The Ukrainian Foreign Intelligence Service reported that Russian manufacturers only supply 30 to 45 percent of the necessary components for Russian oil refineries and that the Russian reliance on Chinese equipment has proven problematic due to compatibility issues, which is increasing the repair costs. ISW previously reported on the effectiveness of Western sanctions and the need to strengthen them to prevent Russia form evading their impact via third parties, as well as the effectiveness of Ukrainian strikes on targets inside Russia.[13]

more + maps https://www.understandingwar.org/backgrounder/russian-offensive-campaign-assessment-november-7-2024

8,068 posted on 11/07/2024 11:51:23 PM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 8037 | View Replies]

To: gleeaikin; SpeedyInTexas
President Zelenskyy and current German opposition leader - and highly likely next Chancellor - had a phone call this morning. He was asking the Ukrainian president:

Merz: “What do you need? Money or equipment?”

Zelenskyy: “We have enough money until 2026. We need weapons. We need long-range weapons with no restrictions.”

Merz has repeatedly demanded to deliver the TAURUS missile. It is not only a good solutions which is specifically required by Ukraine, but also possible without increasing debts in Germany.

https://x.com/tendar/status/1854653975691514082

8,069 posted on 11/08/2024 12:00:19 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 8067 | View Replies]

1.1 Russian losses/minute. How many Norks?


8,070 posted on 11/08/2024 12:05:03 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 8038 | View Replies]

To: gleeaikin

I wonder more and more how much Putin really knows what is going on within his own country and with his “SMO”.

Is it possible that he is so isolated that he truly doesn’t know. Reports suggest that he does not use the internet and is reliant on his inner circle for news and if that inner circle is filling him with BS his decisions are flawed much like hitler in his bunker sending non existent units to fight battles with resources they equally don’t have.

Not sure which is worse the previous situation or one where he does know and is authorizing actions that are happening.

I do think that this war and a negative outcome is a threat to his very existence.

Regardless it is fascinating to see civilians and military folks alike basically praying to Putin to save them from the problems they face. Problems directly caused by putins actions or actions made in his name.


8,071 posted on 11/08/2024 4:39:43 AM PST by blitz128
[ Post Reply | Private Reply | To 8067 | View Replies]

To: AdmSmith

What Trump’s Election Could Mean For The War In Ukraine
Ukraine faces pitfalls and opportunities under a new Trump administration.
https://www.twz.com/news-features/what-trumps-election-could-mean-for-the-war-in-ukraine


It makes no sense fro Trump to support Israel against existential threats, while denying the same to Ukraine.


8,072 posted on 11/08/2024 5:11:30 AM PST by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 8070 | View Replies]

To: PIF
Russian infantry groups were detected by thermal imaging and attacked by the 3rd Assault Brigade.

Group by group, they were neutralized.

Units involved: 1st Mechanized, 1st Assault, and UAV Battalion.

https://x.com/NOELreports/status/1854792110118961632


8,073 posted on 11/08/2024 5:17:38 AM PST by FtrPilot
[ Post Reply | Private Reply | To 8072 | View Replies]

To: PIF
Russian media report a fire at an oil refinery in Russian Saratov after a drone attack.

Waiting for more information.

https://x.com/Gerashchenko_en/status/1854775538788807004

Saratov on Google Maps


8,074 posted on 11/08/2024 5:24:03 AM PST by FtrPilot
[ Post Reply | Private Reply | To 8073 | View Replies]

To: FtrPilot

Reporting From Ukraine:
https://www.youtube.com/@RFU/videos

Reporting From Ukraine Uncensored Combat Footage (from this and past Reports) is found on Telegram:
https://t.me/RFUEnglish or @RFUEnglish
[ You need to have the Telegram app to view the larger videos. ]

The complete transcript.

[ Putin’s Gamble. Battle For Kurakhove is the Turning Point ]


Today [ Nov 08 ], the most important updates come from the Kurahove direction.

Under intense pressure from a sweeping Russian offensive, Ukrainian forces in the Kurahove salient face significant risks as they work tirelessly to stabilize the situation across multiple attack vectors. With fortified defensive positions, targeted counterassaults, and the deployment of advanced equipment, Ukrainian troops strive to hold their ground and avert a Russian breakthrough that could jeopardize operational-level control.

Following the capture of Vuhledar, Russian forces have sought to sustain and intensify their offensive momentum in the area. In recent days, they have launched a large-scale assault across 5 attack vectors, aiming to encircle Ukrainian forces within the emerging salient.

The salient primarily spans flat terrain, lacking significant elevation, with the Sukhi Yaly River as the only notable geographic feature. This river cuts through the center of the salient, flowing alongside a series of connected settlements.

Consequently, Russian forces have been advancing both north and south of the river. More critical, however, are the logistical routes, particularly the N-15 highway from Zaporizhzhia to Kurakhove. If this route is compromised - either by an advance directly from Kurakhove or from southern attack vectors - it would severely threaten Ukrainian supply lines across the region.

In the northern part of the salient, the primary attack direction targets Kurakhove, where Russian forces aim to establish a foothold and begin the battle for the town. Positioned at Ostrivske and Maksymilianivka, Russian troops are limited to advancing along a single, heavily fortified and mined route to Kurakhove, tightly guarded by Ukrainian forces.

Despite continuous mechanized assaults, Ukrainian defenders have prepared formidable defensive positions within Kurakhove. After several attempts, isolated Russian units managed to breach the town’s outskirts, but their supply lines were cut, leading to their elimination. Since then, the situation in this sector has stabilized.

South of the main northern vector, the 2nd offensive axis originates from Heorhiivka and Pobieda. This area remains relatively stable, underscored by a recent Ukrainian advance southwest of Pobieda. Russian forces largely avoid the heavily mined zones here, focusing instead on concentrated efforts to infiltrate through aligned settlements where resistance may be lighter.

The 3rd attack vector focuses on advancing through a line of settlements toward Kostiantynivka and Yalizavetivka, where intense fighting has stalled Russian progress. Even before reaching these settlements, Russian forces must push through dense tree lines that serve as a natural barrier. Ukrainian defenses in this sector include some of their most capable units, notably the 33rd Mechanized Brigade.

According to their spokesperson, Nazar Voitenkov, Leopard 2A4 tanks are now deployed to neutralize enemy trenches, fortified sites, and any reclaimed Russian positions. Recently geolocated footage shows 2 Leopard 2A4s moving toward Russian positions in a tree line, launching close-range attacks that devastate the target. After completing the assault, the tanks withdraw, continuing to provide suppressive fire.

Ukrainian forces are not alone in deploying advanced equipment. Recent geolocated images reveal that Russian forces have moved one of their remaining BMP-T “Terminator” units to the area. [ Maybe 4 of these units remain ]. Known for its high fire intensity, this rare armored fighting vehicle is designed to lead assaults alongside tanks, using its automatic cannons to suppress infantry. The presence of the Terminator in this region signals Russia’s high-priority intent to push forward along the line of settlements.

This time, paratroopers from the 79th Separate Air Assault Brigade successfully destroyed the Terminator using Mavic 3 drones equipped with grenade payloads.

First, they immobilized the vehicle by targeting its engine and transmission compartment, effectively bypassing its “anti-drone” grid defenses. The 79th Brigade later confirmed the complete destruction of the rare BMP-T.

At the southern edge of the salient, the 4th and 5th attack directions branch into multiple vectors: one toward Trudove, another toward Maksymivka, and a 3rd toward Yasna Poliana. Here, Russian forces, spearheaded by the 40th Naval Infantry Brigade, exert intense pressure.

Following substantial gains at Bohoyavlenka and Yasna Poliana, Ukrainian forces were compelled to withdraw from Novoukrainka due to exposure to crossfire from multiple vectors and the imminent risk of encirclement.

Ukrainian forces continue to struggle to stabilize the southern part of the salient, where Russian advances have been most pronounced in recent days. The immediate objective is clear: to reach the N15 Zaporizhzhia-Donetsk highway. Securing this route would critically disrupt Ukrainian logistics across the salient, potentially forcing a full Ukrainian withdrawal from the region.

Overall, since the fall of Vuhledar, Russian forces have intensified efforts around Kurakhove, seeking to capitalize on their momentum while racing against the onset of heavy rains and mud. Current estimates suggest that up to 1/3rd of Russia’s total offensive activity on the front line is concentrated here.

Conditions along the salient are uneven: the northern sectors are relatively stable, while Ukrainian forces face mounting pressure in the south, particularly at the pincer’s edge. Holding this salient is critical for Ukraine.

If Russian forces clear it entirely, they could link this advance to operations further north targeting the strategic city of Pokrovsk, achieving a substantial push toward the Donetsk regional border. In the coming days, Ukrainian forces will aim to stabilize the situation and put the Russian momentum to a halt.


8,075 posted on 11/08/2024 5:28:48 AM PST by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 8060 | View Replies]

To: PIF; SpeedyInTexas; gleeaikin; FtrPilot

North Korea is now able to accurately strike US cities with nuclear weapons thanks to Russian help. And Russia only gave that help to North Korea in exchange for their help bombing Ukraine.

And Russia does this because Biden forbids Ukraine from winning

https://x.com/JayinKyiv/status/1854603094182572339

Video


8,076 posted on 11/08/2024 6:31:02 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 8072 | View Replies]

To: AdmSmith

And Russia does this because Biden forbids Ukraine from winning


Now that sounds like the tactics people say Trump will follow in Ukraine by granting Russia some sort of peace deal.


8,077 posted on 11/08/2024 6:50:20 AM PST by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 8076 | View Replies]

To: blitz128; PIF; AdmSmith; SpeedyInTexas; FtrPilot; BeauBo; USA-FRANCE; BroJoeK; ...

“I wonder more and more how much Putin really knows what is going on within his own country and with his “SMO”. Is it possible that he is so isolated that he truly doesn’t know?”

If Putin is in fact so isolated, is it possible/likely that future President Trump with his telephone to Putin capacity is likely to give him information about what bad shape his military is in? Also that it is regularly murdering Ukraine troop prisoners, for which he is guilty in the eyes of international law? Could Trump do this before he is in office or would this violate secrets laws, if he were only using the kind of information we see at this thread?


8,078 posted on 11/08/2024 7:34:47 AM PST by gleeaikin ( Question authority as you provide links)
[ Post Reply | Private Reply | To 8071 | View Replies]

To: gleeaikin

It is perhaps not a good advice, i.e. making the other party lose face because he has no knowledge of his own country. These are things that others can only say to Putin’s advisers.

During a negotiation with the Soviet Union’s Secretary General on nuclear weapons, one of the American advisers, a general I think it was, said openly how many warheads the Soviets had. Afterwards, at the toilet, a Russian general said to the American “Why did you say that? It is such things that we cannot reveal to the politicians in Moscow.”


8,079 posted on 11/08/2024 8:15:23 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 8078 | View Replies]

To: PIF
A fight between Orc and Ukrainian FPV drone

https://x.com/gettylegion2/status/1854599152954413413


8,080 posted on 11/08/2024 8:59:50 AM PST by FtrPilot
[ Post Reply | Private Reply | To 8077 | View Replies]


Navigation: use the links below to view more comments.
first previous 1-20 ... 8,041-8,0608,061-8,0808,081-8,100 ... 22,221-22,224 next last

Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.

Free Republic
Browse · Search
Bloggers & Personal
Topics · Post Article

FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson