Skip to comments.
Attack On Europe: Documenting Russian Equipment Losses During The 2022 Russian Invasion Of Ukraine (2 year anniversary)
ORYX ^
| Since February 24, 2022 and daily
| ORYX
Posted on 02/24/2024 5:59:01 AM PST by SpeedyInTexas
This list only includes destroyed vehicles and equipment of which photo or videographic evidence is available. Therefore, the amount of equipment destroyed is significantly higher than recorded here. Loitering munitions, drones used as unmanned bait, civilian vehicles and derelict equipment are not included in this list. All possible effort has gone into avoiding duplicate entries and discerning the status of equipment between captured or abandoned. Many of the entries listed as 'abandoned' will likely end up captured or destroyed. Similarly, some of the captured equipment might be destroyed if it can't be recovered. When a vehicle is captured and then lost in service with its new owners, it is only added as a loss of the original operator to avoid double listings. When the origin of a piece of equipment can't be established, it's not included in the list. The Soviet flag is used when the equipment in question was produced prior to 1991. This list is constantly updated as additional footage becomes available.
(Excerpt) Read more at oryxspioenkop.com ...
TOPICS: Military/Veterans
KEYWORDS: 0killthisthread; 1637borders; 3daywar; agitprop; alfredeblitz; americalast; angrykeywordtroll; anotherputinfail; anydaynowukrainewins; assistantdemsonfr; attackoneurope; beaubothebsartist; beauzo; bidenswar; bobomaximus; breevingroom; byepif; byespeedy; cantbreev; cheesymaximus; crazyivan; dailydeathfap; dailypropaganda; deathcult; delusionalzeepers; demyanganul; dimwit; dualcitizenssuck; escalation; fishiemaximus; foreigntrolls; foreigntrollsonfr; formersovietofficers; gabbagabbahey; ghoulishdelight; gleefulnosegold; globohomo; goodriddance; hopium; irynazarutska; itsoveriwasright; jonboy; jonboyputinlover; keiththedimwit; kievstronk; liberalatpost7819; liedaboutleaving; melon; melonballsforever; melonlovesputin; melonlovesrussia; melonmemewarrior; melonmlrs; motherpif; muscovite; nato; omgputinputinputin; oyveygoyim; paidazovfans; paidazovtrolls; paidrussiantrolls; pancakemaximus; phdft; pifpouf; pifpuffs; planetzeep; polygamy; propagandareturns; put; putin; putinsfolly; putinstarted; putinswar; russia; russiandelusions; saintvolodymyr; siloviki; slaviccivilwar; slavictrolls; snufffilmsonfr; snufffilmtx; snuffpornforzeepers; snuffyfromtexas; spammyintexas; speedomaximus; speedycameback; speedyhadenough; speedyintroll; speedyisaliveandwell; speedyisdeadandfried; speedylied; stankazzintx; stankazztexicunt; staygonethistime; stenrynning; stinkstankstunkazz; stpetersburgtrolls; talkingtomypif; tippecanoeandpiftoo; toldyouso; tothelastrussian; tothelastukrainian; ukraine; unhealthyobsession; usaidcheckbounced; usaidtrolls; vladtheimploder; warporn; wellbye; wildberry; yostanky; yurpstronk; zeepercirclejonk; zeepercreepers; zeeperdeathcult; zeeperhomeworld; zeeperloveazov; zeeperpr0n; zeepers; zeepersjustwannazeep; zeeperslovedeath; zeeperslovevindman; zeepersworshipdeath; zeepervictoryparade; zeepharder; zeepyintexas; zipadeedoodah; zot; zottedintexas; zottyintexas
Navigation: use the links below to view more comments.
first previous 1-20 ... 16,321-16,340, 16,341-16,360, 16,361-16,380 ... 20,021-20,036 next last
To: BeauBo
Day 1,191 of the Muscovian invasion. 1,140 [average is 827/day], i.e. more than 47 Russians and Norks/h. Vehicles and fuel tanks more than 75% above average. Motorcycles are not counted yet
16,341
posted on
05/30/2025 4:53:48 AM PDT
by
AdmSmith
(GCTGATATGTCTATGATTACTCAT)
This discussion is well worth a review
MrRelevant: "Why are so many in the pro globalist pro neocon wing of FR saying Russia will roll over Europe next then?
Its clear the Russians are limited , conventionally speaking,"
While Russia's invasion of Ukraine has cost hundreds of thousands of casualties and hundreds of $billions in destruction, Putin still seems prepared to continue fighting indefinitely.
Russia's "Russkiy Mir" propaganda to its own people has not slacked off in the least.
Pres. Trump himself said very recently that Putin still intends to conquer all of Ukraine!
And, at the same time as Russian forces in Ukraine are suffering from shortages of armored equipment, other Russian forces build up their numbers, defenses and equipment along Russia's borders with the Baltics -- Finland, Estonia, Latvia, Lithuania & Poland.
Indeed, Poland is so concerned about threats of Russian aggression that they have doubled their defense spending, from 2.4% of GDP in 2020 to 4.7% today.
The other four Baltic countries have likewise increased defense budgets, and combined they now spend well over $100 billion, at Purchase Price Parity (PPP).
Yes, that sounds like a lot, especially in pre-war terms, but in PPP terms, Russia is now spending around $520 billion per year on its military -- 7.2% of Russia's GDP (PPP).
So, Russians outman and outgun the Baltics by many-to-one, and none of them wants to endure what Ukraine has suffered.
MrRelevant: "And the longer Zelensky insists on silly caveats to end the war, the more likely it is Russia will take even more land."
First, your "silly caveats" are matters of life and death to Ukrainians, so not that "silly" after all.
Second, it appears that in recent days, Russia's operations tempo ("OPTEMPO" in military language) has increased, though not yet back to levels of last fall & winter.
Despite this, I can't see where Russians took any new Ukrainian ground and, indeed, Ukrainians have taken back some land around both Pokrovsk and Kursk.
So, as of today, as since every day of the past three years, Ukrainians are at least holding their own in the face of Russia's unimaginable "meat assaults".
THE ASSASSINS: Important Proclamation by President Johnson; Mr. Lincoln’s Murder Planned by Leading Traitors "The winners, with the enthusiastic assist of the New York Times, wrote the post-war history books.
The real truth about the War of Northern Aggression, and its aftermath, is only known in the heavenly kingdom."
The Lost Cause of the Confederacy narrative began very soon after the war itself ended, and included:
- 1866 Edward Pollard's "The Lost Cause: A New Southern History of the War of the Confederates"
- 1873, Jubel Early's Southern Historical Society Papers began publishing Early's Lost Cause narratives on the Civil War.
- 1881, Jefferson Davis's book "The Rise and Fall of the Confederate Government" expanded the Lost Cause narrative.
- 1894, The United Daughters of the Confederacy (UDC), founded to spread the Lost Cause ideology through textbooks, memorials, and public commemorations, ensuring that future generations learned a sympathetic version of Confederate history.
- 1870s - 1910s, Confederate sympathizers influenced the content of textbooks used in Southern schools, ensuring that their version of history dominated classroom narratives.

- By the 1930s, even Northern school textbooks were adapted to align with the Lost Cause perspectives, leading to a national consensus ensuring that Confederate leaders were portrayed favorably and that slavery was depicted in a less critical light.
- 2002, Thomas DiLorenzo published "The Real Lincoln: A New Look at Abraham Lincoln, His Agenda, and an Unnecessary War" critical of Lincoln and excusing the Lost Cause.
As for the "real truth", there is no doubt that diehard Confederates believed firmly in their cause, and that they adapted their ideas and rhetoric to suit the times, as they were a-changin.
Only here & there can I pick out some glaring errors.
Putin's Little Green Men in Ukraine, 2014:
The biggest is your ludicrous suggestion of "no Russian invasion before 2022"!
Where does that even come from?
How crazy do you have to be to think that way?
The whole world in 2014, and everyone today except adorno, understands that Russia invaded "Ukraine proper" in 2014.
Yes, Crimea was and remains internationally recognized as part of "Ukraine Proper".
Indeed, your words here are the first time I've ever even seen the idea of a "Ukraine Proper".
To everyone in the world except adorno, there is only Ukraine, there is no "Ukraine Proper" or "Ukraine Improper", such words are just nonsense.
What happened in 2014?
- In early 2014, many Russian FSB & other operatives began fomenting violence, killing EuroMaidan demonstrators on behalf of the Putin stooge-traitor Yanukovych government.
- February 21, 2014, the traitor Yanukovych fled Kiev for Moscow and invited Putin to invade Ukraine, which Putin was prepared to immediately do.
- On February 27, 2014, Putin's troops began moving to take control of Crimea, which they soon did.
- By the end of March 2014, Putin's "little green men" began moving to take control of the Donbas.
- On April 17, 2014, Putin himself publicly admitted that Russian forces were operating in Ukraine.
Jedi mind tricks:
How is that not a Russian invasion of "Ukraine Proper"?
What Jedi mind-trick has been performed to make you see it differently?
adorno: "The waste, fraud and abuse is stopping, and it never flowed from helicopters."
"Money thrown from helicopters" is a figure of speech, a metaphor for extravagantly wasteful aid to people in need, of which Musk's DOGE, sadly, uncovered many billions of dollars worth.
That has to stop, but what will then be left is, as of today, unknown.
adorno: "It's a popular thing to talks about the waste of funds happening in Ukraine, but who can actually follow the money and give us the details about where all of it went? Nobody."
I agree, though no uncovered Biden crime family kick-back schemes would surprise me.
adorno: "So, has Trump stopped the funding for Ukraine to continue fighting Russia.
Talk is cheap, but the talk is not backed up with actions."
As I understand, there are still US aid shipments going to Ukraine, though they are the last of the $60 billion approved in April 2024, and no new US aid has been approved.
In the meantime, the Euros have dramatically stepped up both their promises and actual delivers of military and civilian aid to Ukraine.
The Trump plan is to hold future aid to Ukraine as a negotiating lever over Russia, in the event Putin doesn't agree to peace.
How this will all play out is, today, anybody's guess.
adorno: "But democrats will disagree and so will many FR members.
To many FR members, negotiations are a waste of time when the only proper thing to do is to bring our troops and money back home and stop interfering in other countries' internal matters."
Those FReepers walk a fine line attempting, on the one hand, to pretend they support Pres. Trump while, on the other hand, they misrepresent his actual policies.
It will not be so much of a problem for them if Trump's peace talks succeed, but if talks fail, then our pro-Russian FReepers will find it most difficult to maintain their pretenses, I think.
adorno:"That's what I've been saying for more than 3 years. Where have you been?"
I began posting on Ukraine related threads in early 2022.
My first interaction with adorno was here, in September 2024.
adorno:"The amount of aid and types of it and for how long, is very hard to determine.
But, the best gauge about how long and the types of aid, will come from Russia, since the war will continue as long as Russia keeps its troops where they don't belong.
Russia is the deciding factor.
Not Biden did, or what Trump does, or what NATO or the EU do."
Putin's troops will remain in Ukraine so long as Putin thinks they are "winning" there.
They will never withdraw an inch they are not forced to withdraw.
But, out of necessity, Ukraine's strategy has been almost 100% defensive, meaning they cannot push Putin's forces back, but they can make him pay a huge price for every square yard of Ukraine Putin occupies.
That's why the war has dragged on, with no major changes for over three years.
Neither the Americans, nor the Euros, nor even the Ukrainians have ever had a plan to actually defeat the Russians -- instead their whole effort has been devoted to preventing Ukraine's defeat by Russia.
That's why Pres. Trump's peace efforts are necessary and will, we pray, succeed.
adorno: "There cannot be any new approach as long as Putin remains stubborn about taking back Ukraine.
Trump can use a 'new' approach and just pull all aid, but then, that would make matter a whole lot worse."
There have been public hints -- from people like Secretary of State & NSC chief Rubio -- that we are rapidly approaching a "crunch point" in negotiations with Russia.
If the Russians are not serious about peace, then the US will have to walk out of the talks and devote our efforts elsewhere, especially the Middle East and Indo-Pacific regions.
Whether, when and how much US aid will then resume to Ukraine is, as yet, unknown.
Vulcan mind meld:
adorno: "Putin is not a negotiator.
Putin is an aggressor.
Only if Putin sees that he cant win and is losing badly, will he negotiate, but then, it will be the same kind of 'negotiation' that took part to end WWII.
Being forced into a pullout, via force, is the only thing Putin understands, unfortunately."
Now, suddenly, we've gone from Jedi mind tricks to a Vulcan mind meld -- those are my words exactly!
- May the 4th be with you!
- Today is Revenge of the 5th.
- Live long and prosper, FRiend.
ANKE69:
"Mark your calenders and book your flights to the wonderful war torn city of Kiev for the most prominent annual LGBTQ+ event in the country" 2024 Kiev Pride march:
Kiev is a city of around 3 million.
2024's Pride Day march attracted around 500 people.
No other city in Ukraine attracts even a few dozen Priders.
In the meantime, the US holds Pride Day marches in hundreds of cities each year, some (NYC, Chicago) attracting millions of marchers, others (SF, LA & DC) with hundreds of thousands, and dozens of US cities with tens of thousands of marchers.
ANKE69: "Btw General Granny, on May 9th, the little homo’s dictatorship will expire once again.
So will he finally let the martial law and general mobilization extension expire and allow the Ukrainian people the elections they deserve or will the greedy, grifting, midget sign another 90 day extension of his dictatorship???"
Volodymyr Zelensky is a happily married family man.
Zelensky and his Servant of the People party, unlike your hero Putin, was legitimately elected against strong opposition in 2019.
After Vlad's 2022 invasion, Ukraine's Parliament (as required by its constitution) imposed martial law, for 90 days, extended as necessary.
Next week Ukraine's parliament will decide whether to extend martial law for another 90 days.
By constitutional law it must, while the country is being invaded & occupied by foreign military forces.
If, in the unlikely event, a peace deal with Russia was signed by May 9, that might make a difference, however, when has Vlad the Invader ever kept a promise to keep the peace?
My guess is, it won't happen, and so Ukraine's parliament will extend martial law for another 90 days.
(left) Zelensky & family circa 2019. (right) Russia's invasion continues, 2022:

To: FtrPilot; BeauBo; blitz128
28MAY2025
Ukrainian Special Forces Helicopter Raid Destroys Dozens of Russian Targets in Kharkiv Region, Exclusive Video .
Ukraine's military intelligence agency has conducted a helicopter-borne assault in the Kharkiv region, deploying troops deep into contested territory in a bid to thwart Russian attempts to expand across the Oskil River, the Defense Intelligence of Ukraine (HUR) announced on May 28. The raid, described as part of a broader spring operation, included combat landings by helicopter—among them a UH-60 Black Hawk, previously reported to be in Ukrainian service.
The HUR published exclusive footage of the operation, featuring combat clips filmed by soldiers from the elite “Timur Special Unit” operating near the Kupiansk front. While the exact date of the assault remains undisclosed, the HUR says the operation was aimed at disrupting Russian efforts to establish new bridgeheads on the Oskil’s right bank.
According to HUR’s statement, Ukrainian special operations forces destroyed or struck approximately 600 Russian underground shelters, as well as nine field ammunition depots and eight river crossings. The losses inflicted on Russian military hardware reportedly include:
49 howitzers and artillery pieces
17 vehicles and motorcycles
3 boats
2 artillery systems
2 tanks
Personnel losses on the Russian side were also heavy. “Russian manpower losses total 439 killed or wounded. Six enemy soldiers were taken prisoner,” HUR reported.
The operation wasn't limited to direct combat. The video released by HUR highlights the multi-pronged nature of the offensive, showing:
Helicopter insertions, assaults, and clearing of enemy positions
Artillery and mortar fire missions
FPV drone strikes eliminating Russian troops
Deep-penetration sabotage missions, including ambushes and captures
Combat medics and drivers operating in the high-risk “red zone”
https://united24media.com/latest-news/ukrainian-special-forces-helicopter-raid-destroys-dozens-of-russian-targets-in-kharkiv-region-exclusive-video-8699
Video https://www.youtube.com/watch?v=MrRBJFQkafE
2.5 min
16,343
posted on
05/30/2025 5:06:53 AM PDT
by
AdmSmith
(GCTGATATGTCTATGATTACTCAT)
To: BeauBo
Kremlin Drains the Last of the National Welfare Fund to Bail Out the Banks The Russian government has begun offloading what remains of the country's National Welfare Fund (NWF) to prop up its sanctioned financial sector, confirming this week that Sovcombank received a subordinated deposit of 29.6 billion rubles. The funds are part of a broader government scheme allocating 300 billion rubles from the NWF to four of Russia's largest banks under the guise of financing the Moscow–St. Petersburg high-speed rail project.
According to the official decree, signed in late April, Sberbank, VTB, Gazprombank, and Sovcombank will each receive massive long-term deposits from the state's sovereign fund—funds originally intended to safeguard Russia's pension system and future economic stability.
Sberbank – 94.2 billion rubles
VTB – 93.2 billion rubles
Gazprombank – 83.1 billion rubles
Sovcombank – 29.6 billion rubles
https://kyivinsider.com/kremlin-drains-the-last-of-the-national-welfare-fund-to-bail-out-the-banks/
16,344
posted on
05/30/2025 5:33:45 AM PDT
by
AdmSmith
(GCTGATATGTCTATGATTACTCAT)
To: AdmSmith

Russia's concept for a high-speed rail line between Moscow and St. Petersburg
The Russian government has begun offloading what remains of the country’s National Welfare Fund (NWF) to prop up its sanctioned financial sector, confirming this week that Sovcombank received a subordinated deposit of 29.6 billion rubles. The funds are part of a broader government scheme allocating 300 billion rubles from the NWF to four of Russia’s largest banks under the guise of financing the Moscow–St. Petersburg high-speed rail project.
According to the official decree, signed in late April, Sberbank, VTB, Gazprombank, and Sovcombank will each receive massive long-term deposits from the state’s sovereign fund—funds originally intended to safeguard Russia’s pension system and future economic stability.
- Sberbank – 94.2 billion rubles
- VTB – 93.2 billion rubles
- Gazprombank – 83.1 billion rubles
- Sovcombank – 29.6 billion rubles
The NWF, once touted as a buffer against global shocks, is now being quietly repurposed as a bailout mechanism for regime-linked financial institutions, many of which are under international sanctions and cut off from Western capital markets. The stated purpose of the deposits is to finance a major infrastructure project—but the structure of the funding tells a different story.
The funds are being issued as subordinated deposits, maturing in 2049, with a symbolic interest rate of 1% on money actually used for project financing. Money not deployed can still earn higher interest via the Central Bank, giving recipient banks incentive to sit on the funds rather than spend them. The terms strictly prohibit early repayment or withdrawal, locking the government into long-term obligations with minimal oversight or flexibility.
The move follows a legislative change passed in December 2024, which amended the Budget Code to allow NWF money to be placed in commercial banks via subordinated deposits. Previously, such operations were restricted to VEB.RF, Russia’s state development bank. The sudden expansion of access was swiftly followed by a wave of agreements benefiting the country’s largest banks.
These latest transfers come amid what the Kremlin calls “financial closure” of the rail project—a 1.788 trillion ruble infrastructure venture set to link Russia’s two largest cities. While authorities insist the initiative is economically self-sustaining, key details remain undisclosed, including the exact terms of syndicated loans and the private interests involved in the “Dve Stolitsy” (Two Capitals) consortium overseeing the project.
Critics argue the project is a smokescreen for deeper financial troubles.
“This isn’t about transport—it’s about survival,” said a Moscow-based economist who asked to remain anonymous. “The banks are under strain, foreign investment has vanished, and the regime is cannibalizing sovereign reserves to hold things together.”
As inflation climbs, regional budgets tighten, and the cost of war continues to mount, the Kremlin’s decision to drain the NWF for long-term bank support highlights a growing desperation inside Russia’s economic leadership. What was once a strategic reserve is now a lifeline for institutions too politically important to fail.
The cost, as always, will be borne by ordinary Russians.
To: AdmSmith
FROM YOUR POST
- Category
- Latest news
Ukrainian Special Forces Helicopter Raid Destroys Dozens of Russian Targets in Kharkiv Region, Exclusive Video
May 28, 2025 13:13
2 min read
- Authors

Ukrainian UH-60 helicopter during a raid on Russian rear positions in the Kharkiv region. (Source: HUR)
Ukraine’s military intelligence agency has conducted a helicopter-borne assault in the Kharkiv region, deploying troops deep into contested territory in a bid to thwart Russian attempts to expand across the Oskil River, the Defense Intelligence of Ukraine (HUR) announced on May 28.
The raid, described as part of a broader spring operation, included combat landings by helicopter—among them a UH-60 Black Hawk, previously reported to be in Ukrainian service.
The HUR published exclusive footage of the operation, featuring combat clips filmed by soldiers from the elite “Timur Special Unit” operating near the Kupiansk front.
While the exact date of the assault remains undisclosed, the HUR says the operation was aimed at disrupting Russian efforts to establish new bridgeheads on the Oskil’s right bank.
According to HUR’s statement, Ukrainian special operations forces destroyed or struck approximately 600 Russian underground shelters, as well as nine field ammunition depots and eight river crossings. The losses inflicted on Russian military hardware reportedly include:
Personnel losses on the Russian side were also heavy.
“Russian manpower losses total 439 killed or wounded. Six enemy soldiers were taken prisoner,” HUR reported.
The operation wasn’t limited to direct combat. The video released by HUR highlights the multi-pronged nature of the offensive, showing:
Helicopter insertions, assaults, and clearing of enemy positions
Artillery and mortar fire missions
FPV drone strikes eliminating Russian troops
Deep-penetration sabotage missions, including ambushes and captures
Combat medics and drivers operating in the high-risk “red zone”
The mission was carried out by an array of elite Ukrainian units under the “Timur Special Unit” umbrella, including Younger, RDK, Brotherhood, Nobody, Stugna, Chimera, Paragon, BDK, Siberian Battalion, Aratta, 1514, Art Division, First Line, and Raven Group.
In a separate recent operation, external drone pilots from HUR’s strike UAV unit destroyed a Russian fuel train inside occupied Zaporizhzhia. The attack hit railway lines between Verkhniy Tokmak, Molochansk, and Fedorivka, targeting a convoy of tanker cars carrying fuel for Russian military vehicles.
Donate Towards Robots, as Well as Other Military Equipment and Supplies to Help Ukraine’s Defenders Fight Off Russian Invaders
Related articles
- Author
- Category
- Latest news
May 27, 2025 14:54
- Author
- Category
- Latest news
May 25, 2025 18:07
- Author
- Category
- War in Ukraine
Apr 29, 2025 13:32
Share:
- Facebook
- Telegram
- Twitter
- Reddit
- Copy Link
Support Ukraine
To: AdmSmith
Very interesting, thanks for posting & thanks for the ping.
"Ukraine's military intelligence agency has conducted a helicopter-borne assault in the Kharkiv region, deploying troops deep into contested territory..."
Only possible if ruzzia doesn't have short range surface-to-air assets in the area.
Clearly, ruzzia has asset allocation issues.
Kudos to Defense Intelligence of Ukraine.
To: JonPreston
Reporting From Ukraine:
https://www.youtube.com/@RFU/videosThe complete transcript.
—
[ Russians Lost Air Superiority. Biggest Swedish Military Aid Package Changes The Game! ]
Today [ Apr 28, 8 pm ], there is an interesting update concerning the defense of Ukrainian skies. Here, the Ukrainian air defense got one of the biggest boosts as reports emerged that a new powerful flying radar from Sweden had probably already arrived in Ukraine. This system will help the Ukrainian air defenses not only in their offensive operations but will also significantly support their ability to defend the Ukrainian rear from constant Russian missile and drone attacks.
Sweden has pledged to deliver two ASC-890 airborne warning and control system planes to Ukraine as part of its largest military aid package to date, valued at approximately 1.16 billion euros. Sweden’s decision marks a significant enhancement in Ukraine’s air defense capabilities.
These aircraft, equipped with advanced Erieye radar systems, are designed to provide long-range surveillance and target identification. While official confirmation is pending, there are reports that a calibration aircraft was flying over western Ukraine, which might indicate Ukrainians are making final preparations, recalibrating and fine-tuning ground-based radars for the arrival of the new Swedish planes.
The ASC-890, based on the Saab 340 airframe, is an airborne early warning and control aircraft. It features the Erieye radar, a fixed, active electronically scanned array mounted atop the fuselage. This radar system offers a detection range of up to 450 km and can track multiple targets simultaneously, including aircraft, missiles, and drones.
By operating at high altitudes of 6,000 meters, the ASC-890 can monitor vast areas, providing real-time data to command centers and enhancing situational awareness. Essentially, aircraft like the ASC-890 serve as flying radar stations and command centers, coordinating air and ground operations effectively, with its compact size and reliability making it ideal for rapid deployment.
In the context of Ukraine’s current defense infrastructure, the ASC-890 represents a substantial upgrade. Ukraine’s existing radar systems are primarily ground-based, and even though some of them have a range of around 350 to 400 km, their immobility limits their range and makes them vulnerable to terrain obstructions. The ASC 890’s airborne platform overcomes these limitations, offering a broader and more flexible surveillance capability. This enhancement is crucial for the early detection of incoming threats, more accurate tracking of them, and a better response time that would allow Ukrainian air defense to intercept air threats more successfully.
The integration of the ASC-890 is particularly significant in light of Ukraine’s acquisition of Western fighter jets, notably the F-16s. After the manufacturer, SAAB, made some updates to improve the interoperability between the 2 systems, the ASC-890 can now provide these aircraft with comprehensive situational awareness, guiding them to targets and alerting them to potential threats.
As a result, these awacs will significantly improve the engagement range of the F-16s, allowing them to use their modern air-to-air missiles at their maximum ranges, as well as providing a significant improvement to the limited radar detection range of the F-16.
This synergy enhances the operational effectiveness of fighter jets, enabling more precise and coordinated missions. Additionally, the ASC-890’s data can even support Soviet-era Ukrainian fighter jets, extending their operational capabilities despite technological disparities. Sharing real-time radar data and threat information with ground-based command centers, Ukrainians can then relay targeting and situational awareness updates to the pilots via secure radio or datalink.
This allows older aircraft, despite lacking modern onboard radars, to operate more effectively by flying with external guidance and warning support.
Contrastingly, Russia’s equivalent platform, the Beriev A-50, has faced significant challenges. Since early 2024, Ukraine has successfully targeted and destroyed at least two A-50 aircraft, utilizing systems like the Patriot missile defense. These losses have compelled Russia to operate its remaining A-50 fleet even further from the front lines, diminishing its surveillance effectiveness over Ukrainian territory. [ Now grounded ]
The reduced presence of A-50s near Ukraine hampers Russia’s ability to conduct continuous airborne surveillance and coordinate air operations effectively.
Overall, the arrival of Sweden’s ASC-890 aircraft is a strategic boon for Ukraine, especially amid uncertainties regarding continued American intelligence support. These aircraft not only bolster Ukraine’s air defense and surveillance capabilities but also ensure greater autonomy in operational planning and threat response.
As the war continues the ASC890 will fill in gaps as a critical asset in safeguarding Ukrainian airspace and enhancing the effectiveness of its aerial operations.
https://www.youtube.com/watch?v=uWyhob-p3wU
To: JonPreston
Reporting From Ukraine:
https://www.youtube.com/@RFU/videosThe complete transcript.
—
[ Ukrainian Bombs Rip Through Strategic Russian Base, Producing up to 9,000 Drones/Month! ]
Today [ Apr 25, 8 pm ], there are a lot of interesting updates from the Russian Federation. Here, flying deep behind enemy lines, Ukrainian long-range drones delivered a devastating blow to the only Russian Shahed production facility. Long-range drones loaded with 250 kilogram bombs tore through the final assembly line, throwing all Russian strike plans into disarray.
The Ukrainian strike happened at Yelabuga, located over 1,200 km away from the frontline. The Ukrainians used 6 drones for the strike on the main Shahed assembly facility, of which 5 Ukrainian drones managed to reach and directly strike their target despite Russian air defenses being present.
The strike led to severe damage to the final assembly line of the drone production facility, creating a bottleneck and disrupting the entire production process within the factory. This assembly is the most technologically complex segment, without which the rest of the drone production process cannot be completed. Targeting this facility hampers Russia’s ability to produce new Shaheds, thereby severely impacting its ability to continue its daily drone strikes on Ukraine.
For the strike, Ukrainians used small A-22 light training planes repurposed as drones to strike critical Russian military and economic infrastructure far beyond the frontline. These drones have a maximum flight range of over 1,500 km, with integrated GPS inertial guidance to conduct precision strikes. Each of these drones has an integrated payload of 250 kg, able to collapse the facility’s roof, already damaging production machinery, which was then followed by the next drone striking the factory floor itself, finishing the job.
The destruction of the assembly line at the Alabuga facility throws a massive wrench into Russian plans, as the Russians are exerting considerable effort to scale up production and increase the number of Shahed drone strikes. Since the launch of this factory, which produced 300 Shahed drones daily before the Ukrainians hit it, Russia has steadily increased the number of Shahed strikes each month.
Following the completion of the Alabuga drone production complex, the Russians continued to increase their production output, launching a massively increased number of Shahed drone strikes in the past 6 months. This number could have risen to 9,000 by the end of April, prompting the Ukrainians to urgently develop a plan to strike the Russian Shahed production facility.
The strike on the Alabuga plant was additionally prompted by the recent Russian development of an analogue to Ukraine’s Palianytsia jet-propelled drone. The upgraded Shahed, called the Geranium-3, features a turbojet engine for increased speed, raising from 200 kph to 600. This enhancement makes it much harder for Ukrainian mobile air defense units to intercept them, primarily relying on truck-mounted machine guns and autocannons to take down the Shaheds.
Western sources report that the Alabuga factory was a key producer of these new Russian jet-powered Shahed drones. With the new drones being significantly more difficult to intercept for conventional Ukrainian mobile air defense units, Ukraine would have had to rely on more expensive and very limited missile defense systems to protect its cities.
Destroying Russian production capabilities before these drones could be produced and implemented on a larger scale was a strategic play to prevent the Russians from exploiting weak spots in Ukrainian air defense, while the laser air defense is still in the early stages. This also shows that Ukrainians know the locations of these critical Russian factories, and can continue to target them, if they struggle to intercept the new Shaheds.
While Ukrainians have many potential targets to hit, they must choose wisely, due to the amount of time needed to plan and set conditions for such complex aerial operations, making it impossible to strike every location simultaneously.
Overall, the Ukrainians conducted a precision strike on the largest and most important Russian drone production facility, over a 1,000 km away from the frontline, causing massive damage to its production capabilities and greatly diminishing the number of drones available for further Russian strikes. The effects of the Ukrainian strike will be evident, with the planned Russian increase of Shahed strikes not becoming a reality.
Lastly, the strike demonstrates Ukraine’s constant awareness of potential Russian threats, making educated decisions on which facilities to hit with the most urgency, to achieve the most significant effect.
https://www.youtube.com/watch?v=-Tr9_gR1_6w
To: JonPreston



Russian Spokeswoman, Maria Zakharova regarding the "cocain" video of Macron, Starmer and Merz:
"In the video: the President of France, the Prime Minister of Britain, and the Chancellor of Germany.
Having pushed Zelensky into yet another hellish intrigue to sabotage a settlement and continue the bloodshed in Europe, like in the joke, the Frenchman, the Englishman, and the German got on a train and... took a hit.
Apparently, they did it so thoroughly that they forgot to hide their paraphernalia (a little baggie and a spoon) before the journalists arrived.
The fate of Europe is being decided by dependent and temporary figures—in every sense of the word.
Incredible footage. It's as if the Almighty Himself is pulling back the curtain on this foul gathering, so that 'those with eyes may see.'
In 2022, I asked a Western ambassador: 'How can you supply weapons to the unbalanced drug addict Zelensky? He’s been on cocaine for years!'
And I got the reply: 'For the EU, that’s normal — many Western leaders use.'"
***********
To: JonPreston
🍈

To: PIF
To: JonPreston
Please do not repeat my old posts. If you want to comment on them, a link is enough.
16,353
posted on
05/30/2025 6:08:27 AM PDT
by
AdmSmith
(GCTGATATGTCTATGATTACTCAT)
To: blitz128
To: AdmSmith
I simply post the material in your link, it certainly isn't repeating (not that some posts aren't worth deeper discussion)
Let's start here
DISCUSS
DISCUSS
To: AdmSmith
To: PIF
To: blitz128
To: PIF
Navigation: use the links below to view more comments.
first previous 1-20 ... 16,321-16,340, 16,341-16,360, 16,361-16,380 ... 20,021-20,036 next last
Disclaimer:
Opinions posted on Free Republic are those of the individual
posters and do not necessarily represent the opinion of Free Republic or its
management. All materials posted herein are protected by copyright law and the
exemption for fair use of copyrighted works.
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson