Free Republic
Browse · Search
Bloggers & Personal
Topics · Post Article

Skip to comments.

Attack On Europe: Documenting Russian Equipment Losses During The 2022 Russian Invasion Of Ukraine (2 year anniversary)
ORYX ^ | Since February 24, 2022 and daily | ORYX

Posted on 02/24/2024 5:59:01 AM PST by SpeedyInTexas

This list only includes destroyed vehicles and equipment of which photo or videographic evidence is available. Therefore, the amount of equipment destroyed is significantly higher than recorded here. Loitering munitions, drones used as unmanned bait, civilian vehicles and derelict equipment are not included in this list. All possible effort has gone into avoiding duplicate entries and discerning the status of equipment between captured or abandoned. Many of the entries listed as 'abandoned' will likely end up captured or destroyed. Similarly, some of the captured equipment might be destroyed if it can't be recovered. When a vehicle is captured and then lost in service with its new owners, it is only added as a loss of the original operator to avoid double listings. When the origin of a piece of equipment can't be established, it's not included in the list. The Soviet flag is used when the equipment in question was produced prior to 1991. This list is constantly updated as additional footage becomes available.

(Excerpt) Read more at oryxspioenkop.com ...


TOPICS: Military/Veterans
KEYWORDS: 1637borders; 3daywar; agitprop; alfredeblitz; americalast; angrykeywordtroll; anotherputinfail; anydaynowukrainewins; assistantdemsonfr; attackoneurope; beaubothebsartist; bidenswar; bobomaximus; breevingroom; byepif; byespeedy; cantbreev; cheesymaximus; crazyivan; dailydeathfap; dailypropaganda; deathcult; delusionalzeepers; demyanganul; dimwit; dualcitizenssuck; escalation; fishiemaximus; foreigntrolls; foreigntrollsonfr; formersovietofficers; gabbagabbahey; ghoulishdelight; gleefulnosegold; globohomo; goodriddance; hopium; itsoveriwasright; jonboy; jonboyputinlover; keiththedimwit; kievstronk; liberalatpost7819; liedaboutleaving; melon; melonballsforever; melonlovesputin; melonlovesrussia; melonmemewarrior; melonmlrs; motherpif; muscovite; nato; omgputinputinputin; oyveygoyim; paidazovfans; paidazovtrolls; paidrussiantrolls; pancakemaximus; phdft; pifpouf; pifpuffs; planetzeep; polygamy; propagandareturns; put; putin; putinsfolly; putinstarted; putinswar; russia; russiandelusions; siloviki; slaviccivilwar; slavictrolls; snufffilmsonfr; snufffilmtx; snuffpornforzeepers; snuffyfromtexas; spammyintexas; speedomaximus; speedycameback; speedyhadenough; speedyintroll; speedyisaliveandwell; speedyisdeadandfried; speedylied; stankazzintx; stankazztexicunt; staygonethistime; stenrynning; stinkstankstunkazz; stpetersburgtrolls; talkingtomypif; tippecanoeandpiftoo; toldyouso; tothelastrussian; tothelastukrainian; ukraine; unhealthyobsession; usaidcheckbounced; usaidtrolls; vladtheimploder; warporn; wellbye; wildberry; yostanky; yurpstronk; zeepercirclejonk; zeepercreepers; zeeperdeathcult; zeeperhomeworld; zeeperloveazov; zeeperpr0n; zeepers; zeepersjustwannazeep; zeeperslovedeath; zeeperslovevindman; zeepersworshipdeath; zeepervictoryparade; zeepharder; zeepyintexas; zipadeedoodah; zot; zottedintexas; zottyintexas
Navigation: use the links below to view more comments.
first previous 1-20 ... 12,681-12,70012,701-12,72012,721-12,740 ... 18,681-18,688 next last
To: JonPreston
🍈


12,701 posted on 03/02/2025 6:05:27 PM PST by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 12700 | View Replies]

To: BeauBo; FtrPilot

At least one link posted here recently showed a drone flying right into the open/missing door of a house and then the house exploding big time moments later. I am sure the soldier the drone chased inside and the house were well flattened from the explosion shown. Also any supplies inside destroyed or ruined.


12,702 posted on 03/03/2025 2:17:05 AM PST by gleeaikin (oo)
[ Post Reply | Private Reply | To 12695 | View Replies]

To: PIF; FtrPilot
PIF: "Turning one’s back on a known, proven bully, while eschewing one’s long time friends in the same fight, to take on an even larger bully, is a recipe for disaster.
Does 47 plan to treat Taiwan, Japan & the Philippines in the future as he is treating the Europeans now?"

Short answer: yes!

Trump is saying, their free ride at the US expense is over.
From now own, whatever they want from the US they will have to pay, and pay a lot, beginning with defending themselves adequately.

Japan & South Korea are already responding by signing some kind of trade deal with China.
If the US will not defend our allies, those allies will make the necessary accommodations.
Many are also increasing their defense budgets, though Japan is still only 1.2% of GDP and South Korea 2.8 %.
The Philippines spends 1.5% of GDP on national defense.

All of that has to change, but I doubt if every change will be to our liking.

12,703 posted on 03/03/2025 2:40:09 AM PST by BroJoeK (future DDG 134 -- we remember)
[ Post Reply | Private Reply | To 12680 | View Replies]

To: gleeaikin
Ukrainian 47th Magura Brigade destroys Russian military equipment in the Kursk region of Russia.

In that attack, Russians lost four tanks and one APC.

Glory!

https://x.com/Gerashchenko_en/status/1896523222281286102


12,704 posted on 03/03/2025 3:56:16 AM PST by FtrPilot
[ Post Reply | Private Reply | To 12702 | View Replies]

To: PIF
Update:

Ukrainian attack drones successfully conducted one of the deepest strikes of the war tonight, hitting Russia’s Ufa Oil Refinery, over 1300 km behind the frontline.

The Russian refinery is burning.

https://x.com/Osinttechnical/status/1896330776045924488


12,705 posted on 03/03/2025 4:00:42 AM PST by FtrPilot
[ Post Reply | Private Reply | To 12704 | View Replies]

To: blitz128
🇺🇦 🇪🇺 Ukraine and its allies are scrambling to replace the most important American-made weapons in the Ukrainian inventory, - Forbes

❗️Including air-defense missiles. There’s just one realistic option: the SAMP/T. Ukraine already has two SAMP/T batteries, but will need several more—as well as hundreds of Aster missiles for them to fire.

https://x.com/Maks_NAFO_FELLA/status/1896531953873998114


12,706 posted on 03/03/2025 4:07:35 AM PST by FtrPilot
[ Post Reply | Private Reply | To 12705 | View Replies]

To: gleeaikin
Russian Offensive Campaign Assessment, March 2, 2025

Recent Russian official statements in response to the proposed US-Ukraine mineral deal indicate that the Kremlin is trying to sabotage the deal through narratives targeting Ukrainian and American audiences. The Kremlin is claiming that this mineral deal does not benefit Ukraine while also claiming that Russia can make a better offer to the United States, indicating that Moscow sees the deal as harmful to its objectives. Kremlin Spokesperson Dmitry Peskov responded on February 23 to a question about the US-Ukraine mineral deal and whether US pressure would push Ukrainian President Volodymyr Zelensky to “finally sell out all of Ukraine,” including Russia's illegally annexed territories in Ukraine.[1] Peskov claimed that the people in occupied Ukraine decided “long ago” that they wanted to join Russia so “no one will ever sell off these territories” — implying that Zelensky may “sell out” other areas of Ukraine. Russian state television evening news program Vesti claimed on February 24 that the United States is “blackmailing” Ukraine with the mineral deal.[2] A Kremlin-affiliated Russian milblogger claimed on February 22 that “there is nothing good for Kyiv” in a new version of the US-Ukraine mineral deal.[3] The milblogger claimed that the mineral deal is “humiliating” for Ukraine and that Zelensky would be “selling the benefits of his country for nothing” should he sign the deal.

Kremlin officials are also trying to prevent the United States and Ukraine from concluding a mineral deal by making competing offers. Russian President Vladimir Putin claimed to Kremlin journalist Pavel Zarubin on February 24 that Russia has an “order of magnitude” more rare earth materials than Ukraine and stated that Russia can cooperate with both the US government and US companies in capital investment projects for rare earth materials.[4] Putin referred to mineral reserves both within Russia and within occupied Ukraine in his attempts to appeal to the United States to invest in “Russian” rare earth minerals (claiming minerals in occupied Ukraine as Russia's own). Putin also offered to conclude deals with the United States on the supply of Russian aluminum. CEO of the Russian Direct Investment Fund (RDIF) and newly appointed Special Presidential Representative for Investment and Economic Cooperation with Foreign Countries Kirill Dmitriev told CNN on February 24 that Russia is open to economic cooperation with the United States, that the first stage of cooperation would be in the energy sphere, and that such cooperation is key for a “more resilient global economy.”[5]

Russian state media is delaying coverage of select Kremlin statements in order to exploit changing dynamics in the US-Ukrainian relationship and drive wedges between Ukraine and the United States. Zarubin and Russian state media outlets TASS and RIA Novosti amplified on March 2 a previous statement from Peskov about the US decision on February 24 to vote alongside Russia against a Ukrainian- and European-backed UN resolution that recognized Russia as the aggressor in the war.[6] Peskov claimed on February 26 that the Trump administration is “rapidly changing” all of its foreign policies in ways that “largely coincide with [Russia's] vision,” but TASS, RIA Novosti, and Zarubin only reported Peskov’s statements on March 2.[7] Russian state media headlines on March 2 deliberately misrepresented Peskov’s statements such that they appeared to be in response to the February 28 meeting between US President Donald Trump and Ukrainian President Volodymyr Zelensky.[8]

The Kremlin has a vested interest in preventing the United States and Ukraine from signing a mineral deal, as the deal will commit the United States to a long-term investment in Ukraine and Ukraine's sovereignty. The Kremlin is investing significant time and effort into undermining and misrepresenting the US-Ukrainian mineral deal, indicating that the Kremlin views the deal as an impediment to accomplishing Russian President Vladimir Putin's objectives in Ukraine.[9] The mineral deal, even one that does not include text about an American security guarantees for Ukraine, will represent a long-term US economic investment in Ukraine and could be a building block towards additional US assistance or military sales to Ukraine in the future, as US Secretary of the Treasury Scott Bessent observed in an interview to CBS on March 2.[10] Any agreement that ties the United States to an independent and sovereign Ukraine is contrary to Russia's long-term goals of isolating and conquering Ukraine. Putin likely assesses that preventing the US-Ukrainian mineral deal is a necessary step towards pushing the United States into stopping military assistance to Ukraine and abandoning Ukraine altogether. Putin's articulated theory of victory in Ukraine — which assumes that Russia can continue slow, gradual advances in exchange for significant personnel and materiel losses — rests on the assumption that Russia can outlast and overcome US and European security assistance to Ukraine and Ukrainian efforts to mobilize its economy and population to support its defense.[11] Putin is likely attempting to undermine the US-Ukrainian mineral deal in order to prevent deepening US-Ukraine ties in the hope that Russia will be able to destroy or extract significant territorial concessions from Ukraine during future negotiations before Russia's own wartime economic and force generation issues begin to significantly impede Russia ability to advance on the battlefield in 2025 and beyond.[12]

Russian Foreign Minister Sergei Lavrov is attempting to exploit discussions between the United States and the EU about the possible deployment of European peacekeeping forces to Ukraine as part of a future peace settlement in order to reinvigorate the Kremlin's demands for regime change in Ukraine. Lavrov claimed on March 2 that plans to introduce European peacekeeping forces in Ukraine in the future are a continuation of European leaders’ supposed efforts to “incite” Ukraine to “war against [Russia].”[13] Lavrov claimed that the West brought Ukrainian President Volodymyr Zelensky to power using “bayonets” and will use future peacekeeping forces as “bayonets” to “prop up” Zelensky. Lavrov claimed that Europe wants to continue the war in Ukraine through these peacekeeping forces whereas the United States is openly stating its desire to end the war.[14] Lavrov claimed that the introduction of peacekeepers to Ukraine would not eliminate the “root causes” of the war.[15] Lavrov has previously defined the “root causes” of the war as NATO's alleged violation of obligations not to expand eastward and the Ukrainian government's alleged discrimination against ethnic Russians and Russian language, media, and culture in Ukraine.[16] The Kremlin has recently attempted to use this phrase to justify its calls for regime change in Ukraine. Lavrov is exploiting the ongoing discussions in the West about the deployment of peacekeepers to Ukraine in the future to make yet another argument for Russia's longstanding demand for regime change. Lavrov and other Kremlin officials have recently engaged in rhetoric similarly attempting to exacerbate US-European divisions and falsely portraying European countries as wanting to continue the war in Ukraine.[17] The Kremlin is likely attempting to drive a wedge between the United States and Europe to extract concessions in Russia's favor in future peace negotiations and other talks.[18]

https://www.understandingwar.org/backgrounder/russian-offensive-campaign-assessment-march-2-2025

12,707 posted on 03/03/2025 4:08:11 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 12662 | View Replies]


12,708 posted on 03/03/2025 4:09:48 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 12641 | View Replies]

Day 1103 of the Russian invasion. 1,350 i.e. more than 56 Russians and Norks/h. Vehicles and fuel tanks more than 200% and artillery more than 175% above the average.


12,709 posted on 03/03/2025 4:20:35 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 12663 | View Replies]

To: PIF

Mokhnenko Gennadiy
“Why aren’t we wearing suits? Letter to the Blue Jacket in Washington”

Video w Eng subtitles
https://www.youtube.com/watch?v=pxQ88CCMosA


12,710 posted on 03/03/2025 4:29:11 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 12691 | View Replies]

To: BroJoeK

Say goodbye to TSMC, along with most new gadgets, cars, phones, computers, and smart anything - The US will have to buy them from China - if they will sell any to us.

Xi Jinping is loving 47’s new outlook.

Soon we will see 47 aligning US foreign & monetary policy with the BRICS nations.

Have some links for you guys to learn Russian and Chinese - sign up now and beat the rush later.


12,711 posted on 03/03/2025 4:47:47 AM PST by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 12703 | View Replies]

To: BroJoeK; gleeaikin; FtrPilot; AdmSmith

🇺🇦💰 Rich Ukrainians throw elaborate parties, buy luxury cars, and vacation at elite European resorts

🪖💀 Meanwhile, poor Ukrainian men are sent as cannon fodder against Russian drones and artillery

🧵This video compilation will make YOUR BLOOD BOIL👇

pic.twitter.com/DU2Edn5lbC— NewRulesGeopolitics (@NewRulesGeo) March 3, 2025


12,712 posted on 03/03/2025 4:48:00 AM PST by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 12703 | View Replies]

To: PIF
Soon we will see 47 aligning US foreign & monetary policy with the BRICS nations.

Seems to me you are calling President Trump a traitor.

12,713 posted on 03/03/2025 4:49:27 AM PST by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 12711 | View Replies]

To: AdmSmith
Russia's advances have ground to a halt, now the lowest in 9 months, with Ukraine picking up momentum.

February Final Numbers

Russian gains
329.14km²
Down by
-33.92% from previous month

Ukraine Gains
149.01km²
+153.15% from previous month

https://x.com/JayinKyiv/status/1896504069843476619


12,714 posted on 03/03/2025 4:55:37 AM PST by FtrPilot
[ Post Reply | Private Reply | To 12710 | View Replies]

To: FtrPilot

Cable new this morning announced that the US is halting all cyber operations against Russia - we will see.


12,715 posted on 03/03/2025 4:57:39 AM PST by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 12714 | View Replies]

Reporting From Ukraine:
https://www.youtube.com/@RFU/videos

Reporting From Ukraine Uncensored Combat Footage (from this and past Reports) is found on Telegram:
https://t.me/RFUEnglish or @RFUEnglish
[ You need to have the Telegram app to view the larger videos. ]

The complete transcript.

[ Ukrainian Forces Push Forward And Reclaim Ground! ]

Today [ Mar 02, 8 pm ], there are a lot of important updates from the Pokrovsk [ Avdiivka ] direction.

Here, Ukrainians executed a coordinated assault to reclaim Kotlyne, breaking through Russian defenses in a powerful shock assault.

With Russian defenses horribly undermanned and understrength, elite Ukrainian assault units exploited their weaknesses to the maximum effect.

The goal of the Ukrainian forces in this area is to retake control of the settlement of Kotlyne. Russians are trying to use Kotlyne to cut off the main supply road leading into Pokrovsk. By retaking Kotlyne, Ukrainians would not only force Russians to halt their flanking operations, but also restore their ground lines of communication with Ukrainian forces in Udachne, while encircling the Russians in the industrial zone of Kotlyne.

To achieve this, the Ukrainians conducted a multi-phase ground assault operation. The Ukrainian plan was first to suppress the Russian forces in Kotlyne with intense drone strikes and artillery shelling, preventing them from maintaining their defenses and blocking their reinforcements.

Subsequently, special forces and paratroopers would launch a combined assault and clear the village of Russian forces. The main advantage of the Ukrainian forces in this area is that they previously dismantled the outer perimeter of Russian defenses of Kotlyne with several special forces raids.

Furthermore, due to the constant Ukrainian drone and artillery strikes on Russian logistics, Russian forces on the frontline were increasingly undermanned and understrength. Russians could only maintain a platoon-sized force of 40 to 50 soldiers in the town, roughly a quarter of what they would need to mount a proper defense.

Additionally, as Russian forces could only move to Kotlyne on foot, they had been unable to strengthen their defenses with any heavy weapons, leaving the Russian soldiers in Kotlyne dangerously outmatched.

On the other hand, Russians maintained control over the industrial zone of Kotlyne, providing powerful defensive positions for the Russians. This would make any head-on assault of these facilities a bloody endeavor, as Ukrainian commanders devised a plan to starve out the Russians instead.

Combat footage from the area reveals how the Ukrainian forces initiated their counterattack with intense drone and artillery strikes on Russian positions in a compound guarding the entry into Kotlyne.

After dismantling Russian firing positions, Ukrainian special forces from the 3rd Regiment conducted thunder run assaults to cause further chaos in the compound. The Ukrainians used speed and shock to overwhelm the remaining Russian defenders, firing through the walls of buildings with .50 calibre machine guns as if they were made of paper.

By doing this, the Ukrainian special operators drove past and into the Russian rear, breaking the enemy’s cohesion and causing massive casualties as Russians tried desperately to mount a defense.

These thunder runs rendered Russians incapable of setting up an organized resistance against the main Ukrainian force, allowing elite Airborne units from the 25th Brigade to conduct the ground assault to capture the village.

The Ukrainian paratroopers capitalized on the shock created by the special forces, clearing out the remaining Russian positions in the village in house-to-house combat. All the while, Ukrainian heavy drones circled the town, providing direct fire support for the ground assault units with drone-dropped grenades.

Finally, the last remaining Russian positions at Kotlyne, consisting of dugouts and trench networks in the tree lines surrounding the settlement, were cleared by the 425th Assault Battalion to consolidate complete control of the village. Additional footage reveals how five Ukrainian operators from the 130th Skala Battalion managed to corner 10 Russian soldiers in a dugout.

Ukrainians pinned them down with grenades and small arms fire, allowing them to surround the dugout, killing 8 Russian soldiers and taking 2 prisoners.

In the end, Ukrainians successfully recaptured the northern part of Kotlyne and are currently actively working to clear the thick tree belt along the railway line to the south. By further tightening the already narrow corridor to the Russian position in the industrial zone, Russians have been effectively taken into a pocket.

While Russian commanders will likely attempt to mount a counteroffensive to push Ukrainians back, they continue to be unable to coordinate larger assaults, due to Ukrainian disruption strikes in the Russian rear, meaning that Ukrainians are likely to restore complete control over the surrounding area as well.


12,716 posted on 03/03/2025 4:58:05 AM PST by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 12715 | View Replies]

To: PIF
🇺🇦 🇹🇷 The training of future employees of the Ukrainian Baykar plant is already underway in Turkey.

🦅 The company is training 20 students of the Kyiv Aviation Institute and 14 future employees, who are mastering the necessary skills to launch the production of drones.

https://x.com/Maks_NAFO_FELLA/status/1896534683925815625


12,717 posted on 03/03/2025 5:00:51 AM PST by FtrPilot
[ Post Reply | Private Reply | To 12714 | View Replies]

To: PIF
Cable new this morning announced

Cable new?

🍈

12,718 posted on 03/03/2025 5:10:54 AM PST by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 12715 | View Replies]

To: SpeedyInTexas

KEYWORDS: 3daywar; agitprop; alfredeblitz; americalast; angrykeywordtroll; anotherputinfail; anydaynowukrainewins; assistantdemsonfr; attackoneurope; beaubothebsartist; bidenswar; bobomaximus; breevingroom; byespeedy; cantbreev; cheesymaximus; crazyivan; dailydeathfap; dailypropaganda; deathcult; delusionalzeepers; dimwit; dualcitizenssuck; escalation; fishiemaximus; foreigntrolls; foreigntrollsonfr; formersovietofficers; gabbagabbahey; ghoulishdelight; gleefulnosegold; globohomo; goodriddance; hopium; itsoveriwasright; jonboy; jonboyputinlover; keiththedimwit; kievstronk; liberalatpost7819; liedaboutleaving; melon; melonballsforever; melonlovesputin; melonlovesrussia; melonmemewarrior; melonmlrs; motherpif; muscovite; nato; omgputinputinputin; oyveygoyim; paidrussiantrolls; pancakemaximus; phdft; pifpouf; pifpuffs; planetzeep; polygamy; propagandareturns; put; putin; putinsfolly; putinstarted; putinswar; russia; russiandelusions; siloviki; slaviccivilwar; slavictrolls; snufffilmsonfr; snufffilmtx; snuffpornforzeepers; snuffyfromtexas; spammyintexas; speedomaximus; speedycameback; speedyhadenough; speedyisaliveandwell; speedylied; stankazzintx; stankazztexicunt; staygonethistime; stenrynning; stinkstankstunkazz; stpetersburgtrolls; talkingtomypif; tippecanoeandpiftoo; toldyouso; tothelastrussian; tothelastukrainian; ukraine; unhealthyobsession; usaidcheckbounced; usaidtrolls; vladtheimploder; warporn; wellbye; wildberry; yostanky; yurpstronk; zeepercreepers; zeeperdeathcult; zeeperhomeworld; zeeperloveazov; zeeperpr0n; zeepers; zeepersjustwannazeep; zeeperslovedeath; zeeperslovevindman; zeepersworshipdeath; zeepervictoryparade; zeepharder; zipadeedoodah; Click to Add Keyword


12,719 posted on 03/03/2025 5:48:59 AM PST by dynoman (Objectivity is the essence of intelligence. - Marilyn vos Savant)
[ Post Reply | Private Reply | To 1 | View Replies]

To: BeauBo
Partisans in Tver burned down a command post with a target illumination radar and missile guidance system of the S-300 air defense complex.

The cost of the destroyed scrap metal was approximately $160 million.

https://x.com/wartranslated/status/1896551707754237984


12,720 posted on 03/03/2025 5:56:00 AM PST by FtrPilot
[ Post Reply | Private Reply | To 12717 | View Replies]


Navigation: use the links below to view more comments.
first previous 1-20 ... 12,681-12,70012,701-12,72012,721-12,740 ... 18,681-18,688 next last

Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.

Free Republic
Browse · Search
Bloggers & Personal
Topics · Post Article

FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson