Free Republic
Browse · Search
Bloggers & Personal
Topics · Post Article

Skip to comments.

Attack On Europe: Documenting Russian Equipment Losses During The 2022 Russian Invasion Of Ukraine (2 year anniversary)
ORYX ^ | Since February 24, 2022 and daily | ORYX

Posted on 02/24/2024 5:59:01 AM PST by SpeedyInTexas

This list only includes destroyed vehicles and equipment of which photo or videographic evidence is available. Therefore, the amount of equipment destroyed is significantly higher than recorded here. Loitering munitions, drones used as unmanned bait, civilian vehicles and derelict equipment are not included in this list. All possible effort has gone into avoiding duplicate entries and discerning the status of equipment between captured or abandoned. Many of the entries listed as 'abandoned' will likely end up captured or destroyed. Similarly, some of the captured equipment might be destroyed if it can't be recovered. When a vehicle is captured and then lost in service with its new owners, it is only added as a loss of the original operator to avoid double listings. When the origin of a piece of equipment can't be established, it's not included in the list. The Soviet flag is used when the equipment in question was produced prior to 1991. This list is constantly updated as additional footage becomes available.

(Excerpt) Read more at oryxspioenkop.com ...


TOPICS: Military/Veterans
KEYWORDS: 0killthisthread; 1637borders; 3daywar; agitprop; alfredeblitz; americalast; angrykeywordtroll; anotherputinfail; anydaynowukrainewins; assistantdemsonfr; attackoneurope; beaubothebsartist; beauzo; bidenswar; bobomaximus; breevingroom; byepif; byespeedy; cantbreev; cheesymaximus; crazyivan; dailydeathfap; dailypropaganda; deathcult; deepinthespamforest; delusionalzeepers; demyanganul; dimwit; dualcitizenssuck; escalation; fishiemaximus; foreigntrolls; foreigntrollsonfr; formersovietofficers; freeploader; freeploadingspammer; gabbagabbahey; ghoulishdelight; gleefulnosegold; globohomo; goodriddance; hopium; irynazarutska; itsoveriwasright; jonboy; jonboyputinlover; keiththedimwit; kievstronk; liberalatpost7819; liedaboutleaving; melon; melonballsforever; melonlovesputin; melonlovesrussia; melonmemewarrior; melonmlrs; motherpif; muscovite; nato; omgputinputinputin; oyveygoyim; paidazovfans; paidazovtrolls; paidrussiantrolls; pancakemaximus; phdft; pifpouf; pifpuffs; planetzeep; polygamy; propagandareturns; put; putin; putinsfolly; putinstarted; putinswar; russia; russiandelusions; saintvolodymyr; siloviki; slaviccivilwar; slavictrolls; snufffilmsonfr; snufffilmtx; snuffpornforzeepers; snuffyfromtexas; spammyintexas; speedomaximus; speedycameback; speedyhadenough; speedyintroll; speedyisaliveandwell; speedyisdeadandfried; speedylied; stankazzintx; stankazztexicunt; staygonethistime; stenrynning; stinkstankstunkazz; stpetersburgtrolls; talkingtomypif; tippecanoeandpiftoo; toldyouso; tothelastrussian; tothelastukrainian; ukraine; unhealthyobsession; usaidcheckbounced; usaidtrolls; vladtheimploder; warporn; wellbye; wildberry; yostanky; yurpstronk; zeepercirclejonk; zeepercreepers; zeeperdeathcult; zeeperhomeworld; zeeperloveazov; zeeperpr0n; zeepers; zeepersjustwannazeep; zeeperslovedeath; zeeperslovevindman; zeepersworshipdeath; zeepervictoryparade; zeepharder; zeepyintexas; zipadeedoodah; zot; zottedintexas; zottyintexas
Navigation: use the links below to view more comments.
first previous 1-20 ... 12,281-12,30012,301-12,32012,321-12,340 ... 20,301-20,304 next last
To: JonPreston

12,301 posted on 02/21/2025 12:37:26 PM PST by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 12300 | View Replies]

To: FtrPilot

Pretty disturbing, but if 🍈 wants Trump to eat him, so be it


12,302 posted on 02/21/2025 2:26:19 PM PST by blitz128
[ Post Reply | Private Reply | To 12289 | View Replies]

To: blitz128
🍈


12,303 posted on 02/21/2025 3:29:53 PM PST by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 12302 | View Replies]

To: blitz128

🍈 seriously you shouldn’t be so hard on yourself


12,304 posted on 02/21/2025 4:55:15 PM PST by blitz128
[ Post Reply | Private Reply | To 12302 | View Replies]

To: blitz128
🍈

Hey blitz, with all the Morons Trump is firing tonight in the military, you might want to re-up and apply for one of those open slots


12,305 posted on 02/21/2025 5:30:38 PM PST by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 12304 | View Replies]

To: PIF

Doubt that


12,306 posted on 02/21/2025 5:34:43 PM PST by blitz128
[ Post Reply | Private Reply | To 12276 | View Replies]

To: blitz128

Are you getting a feel for the s’bags here that support this war above America’s interests?


12,307 posted on 02/21/2025 5:42:08 PM PST by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 12306 | View Replies]

To: PIF

🍈 has the diarrhea again, time to take it easy on mom’s hot pockets and Red Bull


12,308 posted on 02/21/2025 5:42:56 PM PST by blitz128
[ Post Reply | Private Reply | To 12295 | View Replies]

To: blitz128

Putin’s interests are not American interests.


12,309 posted on 02/21/2025 5:44:31 PM PST by blitz128
[ Post Reply | Private Reply | To 12308 | View Replies]

To: blitz128
Putin’s interests are not American interests

Biden, and every Democrat politician I can think of, is far more dangerous to Americans that Putin. I have a lifetime of experience as a citizen that proves me right. And isn't it disheartening to see Donald Trump cutting a deal with this Devil, while at the same time pushing Zelensky into a corner? DJT knows who he can deal with and they aren't living in Washington DC or the Ukraine.

12,310 posted on 02/21/2025 5:52:15 PM PST by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 12309 | View Replies]

To: PIF
Кремлевская табакерка

The Kremlin is spreading rumors about Putin's poor health. The president did indeed see doctors, but it's not as Russia's enemies say.

Rumors that Vladimir Vladimirovich has become ill and doctors had to save him have been relayed to us by more than ten sources in the Presidential Administration in recent days. This is not the first time such talk has been going on. We figured out what is going on this time. “I heard from several serious people that Vladimir Vladimirovich's several illnesses have worsened at once. That he almost died, and doctors saved him for several hours. I understand that this is most likely not true. But it's still scary,” a high-ranking source in the Kremlin admitted to us.

The same information, which differs only in minor details (some say that Vladimir Vladimirovich has cancer, others - about heart problems), was repeated to us by several other sources - in the Presidential Administration and the government.

“Rumors about Vladimir Vladimirovich's poor health are being spread by Russia's enemies. First of all, by internal enemies. They want to disrupt our negotiations with the Americans, with Trump (they say, why negotiate with a person who, as these bastards want to show, does not have long left), thereby harming the president and all of Russia in his person,” our source close to Putin noted in this regard. He admitted that the president had recently visited doctors. “But there was nothing urgent. Just routine check-ups due to chronic problems that anyone at that age has. So let the enemies not hope,” the channel's interlocutor added.

https://t.me/kremlin_secrets/5319

12,311 posted on 02/22/2025 12:58:13 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 12294 | View Replies]

To: AdmSmith
Russian Offensive Campaign Assessment, February 21, 2025

The Russian Ministry of Defense (MoD) is reportedly falsely designating former penal recruits as having abandoned their units without authorization (SOCH) to avoid paying them amid continued indicators that Russian authorities are concerned about the war's strain on the Russian economy.[73] Russian opposition outlet Verstka reported on February 20 that Russia designated at least 32 penal recruits of military unit 95378, the 1437th Motorized Rifle Regiment (15th Motorized Rifle Brigade, 2nd Combined Arms Army [CAA], Central Military District [CMD]) as SOCH since October 2024, including personnel pulled from the frontline, beaten in punishment “pits,” transported to unknown locations, and killed in action.[74] (ISW has observed reports that elements of the 15th Motorized Rifle Brigade have been fighting in the Pokrovsk direction since intensified offensive operations in Fall 2024).[75] Verstka reported that the families of the missing soldiers wrote an appeal to Russian President Vladimir Putin for assistance in removing the false SOCH designations.

Verstka reported that some relatives have filed complaints against the 1437th Motorized Rifle Regiment's Acting Chief of Staff Captain Sergei Betonov, who reportedly admitted to relatives that former prisoners were assigned the SOCH status due to an “internal directive” from the MoD. Betonov reportedly told the relatives that his unit designates all penal recruits as SOCH when they perform combat missions and does not remove the designation until the soldiers return from combat. Verstka noted that the relatives believe the Russian MoD does not want to pay them, as relatives can petition Russian courts to redesignate “missing” or “lost” soldiers as “dead” to receive social benefits afforded to relatives of dead soldiers.

ISW has frequently observed reports indicating that Russian penal units sustain especially high casualties in attritional, infantry assaults, and the Russian military likely aims to reduce the high monetary costs associated with these high casualty rates.[76] A Russian milblogger claimed on February 20 that a Russian penal recruit currently in detention in occupied Donetsk Oblast claimed that only 30 personnel of his 240-person unit remained after a month of combat operations due to high casualties.[77] The milblogger claimed that “Storm” penal recruit units regularly are completely restaffed within one or two months.

Russian President Vladimir Putin continues to highlight Russian military units fighting in Kursk Oblast to obscure the role of North Korean forces, as well as to highlight units accused of committing war crimes. Putin awarded the Russian 155th Naval Infantry Brigade with the honorific name “Kursk” on February 21.[78] Putin previously lauded the 155th Naval Infantry Brigade in November 2024 as part of continued efforts to gloss over North Korean forces’ participation in combat operations in Kursk Oblast.[79] The 155th Naval Infantry Brigade is implicated in at least two instances of beheadings and summary executions of Ukrainian prisoners of war (POWs) in Kursk Oblast in October 2024.[80]

Radio Free Europe/Radio Liberty's Russia service Radio Svoboda reported on February 21 that it gained access to data from the Russian MoD’s Main Military Medical Directorate and determined that Russian forces have suffered at least 166,000 wounded who were treated in military hospitals from January 2022 to mid-June 2024.

Radio Svoboda reported that the Russian military units that have suffered the most wounded personnel between February 2022 and June 2024 include the 252nd Motorized Rifle Regiment (3rd Motorized Rifle Division, 20th CAA, Moscow Military District [MMD]), 70th and 71st motorized rifle regiments (both 42nd Motorized Rifle Division, 58th CAA, Southern Military District [SMD]), 15th Motorized Rifle Brigade (2nd CAA, CMD), and 74th Motorized Rifle Brigade (41st CAA, CMD). Radio Svoboda reported that the 76th Airborne (VDV) Division had the most wounded of the VDV, as its 104th, 234th, and 237th VDV regiments suffered a combined 2,400 wounded from February 2022 to June 2024, while the 98th VDV Division sustained the second most wounded with over 1,300, including 800 just from its 331st VDV Regiment including 60 officers. Radio Svoboda reported that the Russian General Staff Main Directorate (GRU) units that suffered the most losses in this period were the 10th and 22nd Spetsnaz brigades.

Radio Svoboda noted that this data only includes Russian soldiers transported to rear military hospitals, also includes those treated in hospitals for injuries and illnesses unrelated to the war and does not include instances when a Russian soldier was treated several times. Radio Svoboda noted that Russian officers sustained higher casualty rates until roughly July 2022 as the Russian military had formed effective communications and moved command posts farther from the frontline following Ukraine's introduction of HIMARS to the battlefield in June 2022.

https://www.understandingwar.org/backgrounder/russian-offensive-campaign-assessment-february-21-2025

12,312 posted on 02/22/2025 1:11:25 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 12261 | View Replies]

To: AdmSmith
Day 1094 of the Russian invasion. 1,140 i.e. more than 47 Russians and Norks/h. Vehicles and fuel tanks more than 290% and artillery systems more than 200% above the average.


12,313 posted on 02/22/2025 1:41:41 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 12262 | View Replies]

To: AdmSmith

One thing that has changed the artillery balance of power is that Russia has lost many of its counter-battery radars and their CBRs have too high of a signature and are especially vulnerable.

66 arty systems makes for a huge daily loss even if they were all mortars.


12,314 posted on 02/22/2025 2:09:59 AM PST by Monterrosa-24 (Saludemos la patria orgullosos)
[ Post Reply | Private Reply | To 12313 | View Replies]

To: AdmSmith

Reporting From Ukraine:
https://www.youtube.com/@RFU/videos

Reporting From Ukraine Uncensored Combat Footage (from this and past Reports) is found on Telegram:
https://t.me/RFUEnglish or @RFUEnglish
[ You need to have the Telegram app to view the larger videos. ]

The complete transcript.

[ Entire Russian Units Lay Down Arms to Ukrainian Forces! ]

Today [ Feb 21, 8 pm ], there are a lot of interesting updates from the Pokrovsk direction.

Here, Ukrainians have decimated Russian logistics through drone strikes and precise artillery fire, creating numerous roads of death in the Russian rear.

With freezing temperatures dropping below 18 degrees Celsius, and being issued donkeys instead of trucks for transport, many Russian soldiers simply opted to wave the white flag to surrender, instead of continuing the fight.

The goal of the Ukrainian forces in this area is to undermine the Russian offensive effort around Pokrovsk. To achieve this, the Ukrainians are constantly striking Russian logistics to prevent the arrival of heavy equipment, soldiers, and supplies to the frontline.

This creates severe issues for the Russian forces on the frontline, including a lack of manpower and armored support, which allows the Ukrainians to conduct rapid and successful counterattacks, which further disrupt the Russian offensive.

The main contributor to high Russian manpower losses is the effectiveness of Ukrainian drone surveillance, and the precision of kamikaze drone units. Both Russian and Ukrainian soldiers report that Ukrainian drones swarm the frontline, making any movement in the open basically impossible, and akin to suicide.

Geolocated footage from Novovasylivka underscores this sentiment, showing the sheer quantity of Ukrainian drones in the sky simultaneously. One drone conducts the strike, while another is an observation drone equipped with a droppable grenade, looking for targets with a thermal camera. The other FPV drone is on standby, ready to strike any other target that might present itself.

Such effective methods of surveillance and precision strikes led to some individual Ukrainian drone operators eliminating over a company of Russian soldiers, between 150 and 200 men, around Pokrovsk alone. Meanwhile, Russian forces lack a sufficient number of experienced drone operators to keep up with Ukrainians, leading to overwhelming Ukrainian drone superiority in this direction.

Ukrainians have not only targeted the Russian frontline, but also disrupted logistics deep behind enemy lines, with precision strikes from drones and artillery. Footage from Russian soldiers shows Russian logistics routes transformed into roads of death, filled with destroyed armored vehicles, trucks, and cars. This destruction has forced Russian troops to resort to civilian vehicles, motorbikes, or even walking to the front.

The lack of proper transport and continuous strikes have slowed logistics, leaving Russian soldiers at Pokrovsk complaining of shortages in food, water, fuel, and equipment, often scavenging these from fallen comrades. With temperatures plunging to minus 18C degrees, many of them also report suffering from frostbite during long marches and time spent idle in the trenches.

In a desperate effort to remedy their collapsing logistics at Pokrovsk, the Russian Ministry of Defense issued donkeys, horses, and mules to soldiers in the Pokrovsk direction. to be used for transport and supply animals. Quite obviously, this provides no real relief to Russian soldiers stuck on the frontline, with animals not being able to compensate for the lack of a strong motorized logistics network.

To many Russian soldiers on the frontline, the use of donkeys, horses, and mules was the final straw, exposing the desperate state of their own military. Ukrainians were well aware of this and strapped loudspeakers to their drones, broadcasting messages to Russian soldiers, offering them to surrender.

Many Russian soldiers decided that surrendering would be the only way they could be adequately fed and treated for their illnesses, leading large numbers of Russian soldiers to give up the fight, as one group of 9 soldiers left their trenches waving the white flag.

Overall, the Ukrainians managed to deplete and strain Russian logistics, stretching the Russian offensive to the point of culmination, and leading to the Russian Ministry of Defense officially issuing donkeys and horses for logistics and transport purposes. Poor logistics reduce the flow of Russian soldiers to the frontline and slows their response time.

Underfed, under-equipped, and under constant counterattacks, Russian soldiers’ morale has now dropped to an all-time low, with surrenders becoming more frequent by the day.

Such circumstances enabled Ukrainians to push back, retake the initiative, and regain ground, an effort which will continue as the collapse of the Russian logistics can lead to a complete collapse of Russian lines west of Pokrovsk.


12,315 posted on 02/22/2025 5:35:06 AM PST by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 12313 | View Replies]

To: PIF
Excellent reporting, thanks for posting!

Below is some video from the Pokrovsk direction.

The 71st Jaeger Brigade repelled a massive Russian mechanized attack in the Pokrovsk direction. Several pieces of heavy equipment were destroyed.

https://x.com/NOELreports/status/1893206952362017161


12,316 posted on 02/22/2025 6:59:21 AM PST by FtrPilot
[ Post Reply | Private Reply | To 12315 | View Replies]

To: All
At night, Russia launched 162 Shahed drones into Ukraine, 82 of them were shot down and another 75 were supressed by electronic warfare.

https://x.com/NOELreports/status/1893195880099954929

Kudos to UKF Air Defense.

12,317 posted on 02/22/2025 7:06:40 AM PST by FtrPilot
[ Post Reply | Private Reply | To 12316 | View Replies]

To: FtrPilot

U.S.-Ukrainian Mineral Deal Getting Close To Fruition
Ukraine Situation Report: If signed, the mineral deal could sooth growing tensions between Trump and Zelensky.
https://www.twz.com/news-features/u-s-ukrainian-mineral-deal-getting-close-to-fruition

[ While making Andri Yermak, who runs the country, very happy, since it will put his beloved Russia in the driver’s seat ]


Drone-Equipped U.S. Marines Now Helping Protect Baltic Sea Submarine Cables
The deployment is part of NATO’s Baltic Sentry mission that was created after several suspected cable sabotage incidents.
https://www.twz.com/space/x-37b-spaceplane-shares-earth-image-for-first-time-as-new-mission-details-emerge

X-37B Spaceplane Shares Earth Image For First Time As New Mission Details Emerge
The photo was captured during the ongoing seventh mission for the shadowy X-37B mini-shuttle, which has seen it enter into higher orbits.
https://www.twz.com/space/x-37b-spaceplane-shares-earth-image-for-first-time-as-new-mission-details-emerge


China’s Sudden Live Fire Naval Drills Off Australia Rattle Canberra
A rare drill in between New Zealand and Australia sent a message and is a sign of China’s growing ability to project naval power far from its shores.
https://www.twz.com/news-features/chinas-sudden-live-fire-naval-drills-off-australia-rattle-camberra


12,318 posted on 02/22/2025 7:20:58 AM PST by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 12317 | View Replies]

To: blitz128
Donkeys in the service of the Russian army. Video filmed by a Ukrainian drone operator shows a Russian infantryman straggling to move a new type of Russian frontline transport equipment.

https://x.com/bayraktar_1love/status/1893237881105232215


12,319 posted on 02/22/2025 7:25:03 AM PST by FtrPilot
[ Post Reply | Private Reply | To 12317 | View Replies]

To: BeauBo
Ukrainian FPV intercepts Russian FPV.

https://x.com/bayraktar_1love/status/1893206461842342102


12,320 posted on 02/22/2025 7:33:52 AM PST by FtrPilot
[ Post Reply | Private Reply | To 12319 | View Replies]


Navigation: use the links below to view more comments.
first previous 1-20 ... 12,281-12,30012,301-12,32012,321-12,340 ... 20,301-20,304 next last

Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.

Free Republic
Browse · Search
Bloggers & Personal
Topics · Post Article

FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson