Free Republic
Browse · Search
Bloggers & Personal
Topics · Post Article

Skip to comments.

Attack On Europe: Documenting Russian Equipment Losses During The 2022 Russian Invasion Of Ukraine (2 year anniversary)
ORYX ^ | Since February 24, 2022 and daily | ORYX

Posted on 02/24/2024 5:59:01 AM PST by SpeedyInTexas

This list only includes destroyed vehicles and equipment of which photo or videographic evidence is available. Therefore, the amount of equipment destroyed is significantly higher than recorded here. Loitering munitions, drones used as unmanned bait, civilian vehicles and derelict equipment are not included in this list. All possible effort has gone into avoiding duplicate entries and discerning the status of equipment between captured or abandoned. Many of the entries listed as 'abandoned' will likely end up captured or destroyed. Similarly, some of the captured equipment might be destroyed if it can't be recovered. When a vehicle is captured and then lost in service with its new owners, it is only added as a loss of the original operator to avoid double listings. When the origin of a piece of equipment can't be established, it's not included in the list. The Soviet flag is used when the equipment in question was produced prior to 1991. This list is constantly updated as additional footage becomes available.

(Excerpt) Read more at oryxspioenkop.com ...


TOPICS: Military/Veterans
KEYWORDS: 1637borders; 3daywar; agitprop; alfredeblitz; americalast; angrykeywordtroll; anotherputinfail; anydaynowukrainewins; assistantdemsonfr; attackoneurope; beaubothebsartist; bidenswar; bobomaximus; breevingroom; byepif; byespeedy; cantbreev; cheesymaximus; crazyivan; dailydeathfap; dailypropaganda; deathcult; delusionalzeepers; demyanganul; dimwit; dualcitizenssuck; escalation; fishiemaximus; foreigntrolls; foreigntrollsonfr; formersovietofficers; gabbagabbahey; ghoulishdelight; gleefulnosegold; globohomo; goodriddance; hopium; itsoveriwasright; jonboy; jonboyputinlover; keiththedimwit; kievstronk; liberalatpost7819; liedaboutleaving; melon; melonballsforever; melonlovesputin; melonlovesrussia; melonmemewarrior; melonmlrs; motherpif; muscovite; nato; omgputinputinputin; oyveygoyim; paidazovfans; paidazovtrolls; paidrussiantrolls; pancakemaximus; phdft; pifpouf; pifpuffs; planetzeep; polygamy; propagandareturns; put; putin; putinsfolly; putinstarted; putinswar; russia; russiandelusions; siloviki; slaviccivilwar; slavictrolls; snufffilmsonfr; snufffilmtx; snuffpornforzeepers; snuffyfromtexas; spammyintexas; speedomaximus; speedycameback; speedyhadenough; speedyintroll; speedyisaliveandwell; speedyisdeadandfried; speedylied; stankazzintx; stankazztexicunt; staygonethistime; stenrynning; stinkstankstunkazz; stpetersburgtrolls; talkingtomypif; tippecanoeandpiftoo; toldyouso; tothelastrussian; tothelastukrainian; ukraine; unhealthyobsession; usaidcheckbounced; usaidtrolls; vladtheimploder; warporn; wellbye; wildberry; yostanky; yurpstronk; zeepercirclejonk; zeepercreepers; zeeperdeathcult; zeeperhomeworld; zeeperloveazov; zeeperpr0n; zeepers; zeepersjustwannazeep; zeeperslovedeath; zeeperslovevindman; zeepersworshipdeath; zeepervictoryparade; zeepharder; zeepyintexas; zipadeedoodah; zot; zottedintexas; zottyintexas
Navigation: use the links below to view more comments.
first previous 1-20 ... 12,241-12,26012,261-12,28012,281-12,300 ... 18,721-18,733 next last
Russian Offensive Campaign Assessment, February 20, 2025

The Financial Times (FT) published an investigation on February 20 supporting ISW’s long-held assessment that Russian military commanders are either complicit in or directly enabling subordinates to execute Ukrainian prisoners of war (POWs) in clear violation of international law.[1] The FT investigation provided additional details and analysis following a significant increase in the number of credible reports of Russian forces executing Ukrainian POWs in 2024 compared to the first two years of the war.[2] FT and experts from the Center for Information Resilience analyzed footage of the executions and used the soldiers’ uniforms to confirm that Russian forces were conducting the executions. FT conducted an investigation into footage of a Russian soldier shooting six unarmed Ukrainian POWs and identified the possible perpetrator as a soldier in a “Storm” penal detachment of the 30th Motorized Rifle Brigade (2nd Combined Arms Army [CAA], Central Military District [CMD]), but noted that the situation warrants further investigation to confirm this soldier's involvement. FT reported that the 30th Motorized Rifle Brigade has been fighting near Pokrovsk since Fall 2024, which is consistent with ISW’s observations.[3] FT noted that Ukrainian frontline units are often the primary source of execution reports and drone footage of executions. FT noted, however, that tracking these executions is challenging because the Ukrainian units do not always relay reports of Ukrainian POW executions to their commanders.[4] FT noted that Ukrainian prosecutors sometimes find out about the executions based on footage published online. FT interviewed the cofounders of a project reportedly affiliated with Ukrainian military intelligence who stated that many Ukrainian units do not publish information about executions “because it has become routine” and that there are likely hundreds of instances of POW executions beyond the “dozens” recorded so far.

FT’s investigation suggests that more senior Russian commanders may also be complicit in issuing orders to execute Ukrainian POWs.[5] Ukrainian officials opened investigations into 43 executions with 109 victims in 2024, and FT analyzed footage of 30 of these instances with 133 victims. The FT investigation found that Russian forces across the frontline — particularly in eastern Ukraine and Zaporizhia Oblast - are executing Ukrainian POWs, not just a few isolated “rogue [Russian] units.” Global Rights Compliance President Wayne Jordash, who is assisting Ukrainian investigations into POW executions, told the FT that Russia is pursuing a “strategy of criminality” in Ukraine, including by torturing, sexually assaulting, and otherwise abusing residents in occupied Ukraine, and that the POW executions are also part of this criminality campaign. Jordash stated that Russian executions of Ukrainian POWs function to degrade Ukraine's military and security apparatus, leaving Ukraine more vulnerable to aggression.

Jordash noted that international law states that individuals who fail to prevent war crimes are also culpable for said war crimes and that government officials calling for POW executions are violating international law.[6] Jordash mentioned specific instances of senior Russian leaders, including Security Council Deputy Chairperson Dmitry Medvedev and Chechen Republic Head Ramzan Kadyrov, explicitly calling for Russian forces to execute Ukrainian POWs. Jordash highlighted that Russian President Vladimir Putin praised the Russian 155th Naval Infantry Brigade (Pacific Fleet) for its actions in combat, which is notable because the 155th Naval Infantry Brigade is has been linked to the beheading of Ukrainian POWs and execution of Ukrainian drone operators in October 2024. Forbes attributed beheadings of Ukrainian POWs in August 2024 and summary executions in October 2024 in Kursk Oblast to the 155th Naval Infantry Brigade.[7] Putin awarded the 30th Motorized Rifle Brigade the “Guards” honorific title in July 2024.[8] FT reported that Putin held highly publicized meetings with two unspecified participants of the Kremlin's “Time of Heroes” veterans program who reportedly executed POWs near Robotyne, Zaporizhia Oblast in May 2024.[9] The Wall Street Journal (WSJ) recently reported that there is a culture of torture and abuse of Ukrainian POWs detained in Russian penal colonies, and taken together these reports suggest that Russian decisionmakers in higher echelons of the chain of command may be implicitly encouraging, explicitly ordering, or failing to stop Russian executions and other abuses of Ukrainian POWs in a system that seems to incentivize such abuses.[10]

Senior Ukrainian intelligence officials reported that North Korean forces are conducting joint operations with Russian forces in Kursk Oblast and are gaining new combat capabilities. Ukraine's Main Military Intelligence (GUR) Head Lieutenant General Kyrylo Budanov told South Korean outlet Chosun Ilbo in an article published on February 17 that [11] Budanov noted that North Korean forces are embedded in Russian units and conduct joint operations in small groups with Russian forces and that North Korean forces move as part of larger Russian units to conduct joint operations. The commander of a Ukrainian platoon operating in Kursk Oblast stated on February 20 that North Korean forces have changed their tactics in the area, reducing the size of their infantry assault groups from 50 personnel to 10 to 15 personnel and moving “more cautiously.”[12] The commander noted that North Korean assault groups are still larger than Russian assault groups. South Korea's National Intelligence Service (NIS) stated in November 2024 that North Korean forces had been training alongside Russian naval infantry and airborne (VDV) units - traditionally more elite forces in the Russian military.[13] Budanov noted that there are more artillery and missile units in Kursk Oblast due to the presence of North Korean troops, but that the GUR has not observed additional North Korean deployments to Russia. GUR Deputy Head Major General Vadym Skibitskyi also told Chosun Ilbo that 1,000 North Korean troops are training on unspecified new military equipment in an unspecified area in Russia. Skibitskyi reported that North Korean forces have rapidly improved their combat effectiveness by adapting to new combat tactics and operating weapons such as tanks and drones. Budanov also confirmed a Reuters report from December 2024 that Russian missile experts have modified North Korean-provided KN-23 ballistic missiles, which previously had a 500 to 1,500 meter margin of error, to make them more precise.[14] The deputy commander of a Ukrainian battalion operating in Kursk Oblast reported on February 16 that North Korean assault groups were attacking in more spread out formations as part of efforts to complicate Ukrainian efforts to strike the attacking forces.[15] North Korean forces reportedly recently withdrew from active combat operations in Kursk Oblast after suffering heavy casualties largely due to Ukrainian drone strikes, and reports that North Korean troops have adjusted their tactics on the battlefield to counter Ukrainian drone strikes indicates that North Korean forces may be learning lessons and internalizing valuable combat experience.

https://www.understandingwar.org/backgrounder/russian-offensive-campaign-assessment-february-20-2025

12,261 posted on 02/20/2025 11:05:52 PM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 12226 | View Replies]

Day 1093 of the Russian invasion. 1,280 i.e. more than 53 Russians and Norks/h. Vehicles and fuel tanks more than 310% and artillery systems more than 140% above the average.


12,262 posted on 02/20/2025 11:10:21 PM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 12228 | View Replies]

To: PIF
Large producers of bread and bakery products have sent notices to retailers about increasing wholesale prices by 10-12% from March 1. Two sources close to different retail chains told Vedomosti about this. The interlocutors did not disclose the names of the companies that sent the notices. Among the reasons for the rise in prices for bakery products, the producers indicated changes in the cost of warehouse and transport logistics, an increase in the tax burden, rising prices for raw materials, etc., Vedomosti’s interlocutors said.

https://www.vedomosti.ru/business/articles/2025/02/21/1093524-riteilerov-uvedomili-ob-uvelichenii-otpusknih-tsen-na-hlebobulochnie-izdeliya

12,263 posted on 02/20/2025 11:25:28 PM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 12259 | View Replies]

To: PIF

Regardless will be a small parade of miles and NK equipment, and perhaps the MIA T-14 breakdown tank


12,264 posted on 02/21/2025 4:13:13 AM PST by blitz128
[ Post Reply | Private Reply | To 12246 | View Replies]

To: blitz128

you forgot the wooden mock ups and rubber balloon vehicles and missiles, The guests of honor will be Xi Jinping, little Kimmy, and one other who cannot be mentioned


12,265 posted on 02/21/2025 4:28:33 AM PST by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 12264 | View Replies]

To: AdmSmith

Reporting From Ukraine:
https://www.youtube.com/@RFU/videos

Reporting From Ukraine Uncensored Combat Footage (from this and past Reports) is found on Telegram:
https://t.me/RFUEnglish or @RFUEnglish
[ You need to have the Telegram app to view the larger videos. ]

The complete transcript.

[ Incredible Operation! Ukrainians Cut Off And Annihilate Russian Troops! ]

Today [ Feb 20, 8 pm ], there is important news from the direction of Pokrovsk.

Here, Ukrainian special forces launched a decisive clearing operation against Russian troops holed up in the Kotlyne industrial zone.

By eliminating dozens of enemies, the Ukrainians once again caused chaos and helped restrain the flanking operation of the Russians on the western part of Pokrovsk.

Ukrainians had the clear objective to eliminate the remaining Russian presence in the area and establish full control over the tactical stronghold in the local industrial complex. This operation was in preparation for weeks, and with Russian forces partially cut off, Ukrainian commanders decided to act.

As these Russian forces were not fully encircled, they remained a significant threat. If they were left unbothered, they could disrupt Ukrainian counterattacks by launching assaults from behind or as a staging ground for future Russian reinforcements.

Clearing the industrial zone would allow Ukraine to focus entirely on pushing back the Russian western pincer, rather than fighting on many fronts simultaneously. Additionally, by pressuring the Russian troops stuck in Kotlyne, Ukraine accelerated their depletion of ammunition and food, especially with them being without a proper supply line.

The Russians were largely cut off from the south, with their only supply route the tree belt along the railway line. While this provides some cover for reinforcements, it is insufficient to sustain prolonged resistance, particularly under sustained Ukrainian pressure.

Additionally, the hardened road leading into Kotlyne from Ukrainian-controlled territory gives Ukrainian forces a direct and secure path for assaults and evacuations. The area is also beyond the optimal range of Russian artillery and drone surveillance, preventing the Russians from blocking Ukrainian access.

Given the complexities of warfare in industrial zones, Ukrainian forces opted for a precise and well-planned operation, which made elite special operations units the best choice for the task. Instead of a full-scale assault that could lead to high casualties, Ukrainians planned to conduct surgical strikes to slowly dismantle their defensive network.

Ukrainians needed to act carefully because, despite the logistical disadvantage, the Russians had a strong defensive position. The industrial zone consisted of relatively intact buildings, with potential underground bunkers and tunnel systems, that allowed them to withstand Ukrainian attacks.

Tall structures provided excellent vantage points for Russian snipers and observers and gave them an oversight of the surrounding area. If Ukrainians hesitated, the Russians could have reinforced their positions, stockpiled supplies, and made any future assault far more costly.

To overcome these obstacles, Ukrainians leveraged their superior drone capabilities around Pokrovsk. Aerial reconnaissance allowed them to pinpoint Russian positions and weaknesses before assaulting them. With real-time intelligence, Ukrainian special forces can move with precision, striking at concentrations of Russian troops before they have time to react.

Geolocated footage from the operation shows how Ukrainian drones identified a large concentration of Russian forces inside a multi-story industrial building. Recognizing the importance of eliminating this stronghold, a special forces team was deployed to strike before the Russians could regroup.

Soon Ukrainian special forces advanced rapidly and stormed the building. Russian troops inside put up heavy resistance, leading to a brutal close-quarters battle, but as a result around 25 of them were eliminated after the Ukrainians cleared room after room. At the end, the buildings were cleared, and Ukrainians secured the regions.

After controlling the buildings for two days, due to a Russian counterattack, a fire broke out inside the building, where the Ukrainians were located, compromising their cover. With smoke spreading and visibility dropping, recognizing the potential danger, they quickly organized an extraction to avoid unnecessary losses.

Humvee armored vehicles were sent in to evacuate the special forces team. Despite the difficult conditions, the Ukrainians managed to temporarily withdraw, without any casualties.

Overall, the daring Ukrainian raid successfully cleared a critical Russian stronghold in Kotlyne and further destabilized the Russians. By executing precise and well-coordinated attacks, Ukrainian forces continued to deny the Russians any lasting foothold for their already weakened offensive.

With each cleared area, the Ukrainians move closer to securing Pokrovsk, ensuring that any attempted Russian advance will face even greater obstacles ahead.


12,266 posted on 02/21/2025 4:35:50 AM PST by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 12263 | View Replies]

Headlines trending on FR pertaining to Ukraine:

Trump Gave Europe Three Weeks to Sign Off on Ukraine ‘Surrender’: MEP
https://freerepublic.com/focus/f-news/4299326/posts

If they do not, than the US will withdraw from Europe.


The Trump Strategy for Ukraine
https://freerepublic.com/focus/f-news/4299323/posts

47 is upset that Zelinski has not supported 47’s policies in the past month.

“At the UN, Ukraine has frequently voted against Israel, a U.S. ally, placing it alongside its worst enemy, Russia.” Never mind that that was during the Biden anti-Israel period. Etc.


U.S. Doubles Down on Demand That Ukraine Sign Minerals Deal
https://freerepublic.com/focus/f-chat/4299255/posts

Not a trade deal, but a “sign or else” deal with the SecTreasury.

Going do far as “a government-affiliated think tank sent a memo to the Kremlin ahead of U.S.-Russia talks this week that was obtained by a Western government. It suggested that Russia offer to grant American companies rights to mineral deposits in occupied Ukraine.”

Demonstrating a foreign policy naivety of a very high order.


Fox News’ Mark Levin criticizes Trump for attacking Zelensky: ‘MAGA doesn’t support Putin’
https://freerepublic.com/focus/f-news/4299239/posts

“Fox News host Mark Levin, a longtime supporter of President Trump, is breaking with the commander-in-chief over his recent attacks on Ukrainian President Volodymyr Zelensky, warning Trump that ‘MAGA doesn’t support Putin.’ “


BREAKING: Ukrainian Lawmaker Confirms US Halted Weapon Deliveries to Ukraine - Reason Is Unclear
https://freerepublic.com/focus/f-news/4299235/posts

“Ukrainian lawmaker Roman Kostenko, who works as the secretary of the Verkhovna Rada’s Committee on National Security, Defense and Intelligence, told reporters on Thursday that the US weapon sales and deliveries have been halted.”


12,267 posted on 02/21/2025 5:18:26 AM PST by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 12266 | View Replies]

To: PIF

Perhaps😎


12,268 posted on 02/21/2025 5:19:18 AM PST by blitz128
[ Post Reply | Private Reply | To 12265 | View Replies]

To: blitz128

More headlines:

Jubilation in Moscow Over Trump’s Gifts to Putin
https://freerepublic.com/focus/f-news/4299293/posts

“In Moscow, it was like Christmas, Easter, and New Year’s all rolled into one. Pundits, bloggers, and officials across Moscow echoed the triumphalism. From their vantage point, fortune has finally turned Russia’s way following three years of humiliating setbacks, including Ukraine’s surprise conquest of a slice of Russia last summer.”

Russia, Russia, Russia!


12,269 posted on 02/21/2025 5:22:34 AM PST by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 12268 | View Replies]

To: PIF

🚨 WOW. Secretary of State Marco Rubio is ticked off after Zelensky has been bad-mouthing Trump while they search for peace.

RUBIO: I said, we need to be paid back some of the $200B in taxpayer money we've given you. He said 'Sure, I need to run it through my legislative… pic.twitter.com/LaxDvCU5he— Eric Daugherty (@EricLDaugh) February 21, 2025

🚨 WOW. Secretary of State Marco Rubio is ticked off after Zelensky has been bad-mouthing Trump while they search for peace.

RUBIO: I said, we need to be paid back some of the $200B in taxpayer money we've given you. He said 'Sure, I need to run it through my legislative process.' I read two days later he's saying he rejected the deal. That's not what happened in that meeting. We're trying to help these guys. Ukraine doesn't directly impact the daily lives of Americans, there should be some gratitude here.

RUBIO CONTINUED: When you see him accusing the President of disinformation, that's counterproductive. President Trump isn't going to take that. He's not going to get gamed. He hopes Zelenskyy isn't trying to hustle the United States, that's not going to be productive here.

12,270 posted on 02/21/2025 5:22:47 AM PST by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 12265 | View Replies]

To: PIF

I don’t think they should be quite that excited.


12,271 posted on 02/21/2025 5:30:02 AM PST by blitz128
[ Post Reply | Private Reply | To 12269 | View Replies]

To: blitz128
Putin dragged out Oresnnik threats once more, said that "the whole world is talking about the Oreshnik missile," and said the temperature of the missile's warhead corresponds to the temperature on the surface of the Sun.

I wonder who gives him this information.

https://x.com/Gerashchenko_en/status/1892937811906404369


12,272 posted on 02/21/2025 6:20:21 AM PST by FtrPilot
[ Post Reply | Private Reply | To 12271 | View Replies]

To: PIF
🇺🇦 🚀 Ukrainian missile "Trembita"

Preliminary characteristics:
▪️flight range up to 200 km
▪️warhead - 20 kg

https://x.com/Maks_NAFO_FELLA/status/1892921301813043415


12,273 posted on 02/21/2025 6:34:27 AM PST by FtrPilot
[ Post Reply | Private Reply | To 12272 | View Replies]

To: FtrPilot

How many of my Senate colleagues secretly have Ukrainian passports?

— Mike Lee (@BasedMikeLee) February 21, 2025


12,274 posted on 02/21/2025 6:37:23 AM PST by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 12272 | View Replies]

To: AdmSmith
💥 Baba-Yaga heavy drone bomber destroyed Russian BTR with personnel inside.

https://x.com/Maks_NAFO_FELLA/status/1892918735008137727


12,275 posted on 02/21/2025 6:53:20 AM PST by FtrPilot
[ Post Reply | Private Reply | To 12273 | View Replies]

To: blitz128

I don’t think they should be quite that excited.

Why not? The Russians are not only being given Ukraine, but potentially, all of Europe.


12,276 posted on 02/21/2025 6:56:58 AM PST by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 12271 | View Replies]

To: FtrPilot

Wonder is Hegseth can get the military to make that drone, as well as millions of cheap FPV drones?


12,277 posted on 02/21/2025 6:59:36 AM PST by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 12275 | View Replies]

To: BeauBo
Collaborator Gubarev has accused the Russian command of committing "genocide against Russian men," highlighting the staggering losses in the "Storm" units.

He revealed that out of 240 mobilized ex-convicts, only 30 are left after a month of fighting. These prisoners often commit crimes to return to jail, seeing it as a preferable alternative to the front lines.

The Russian army has become a meat grinder, where even those with criminal backgrounds choose the safety of a prison cell over the horrors of combat.

https://x.com/wartranslated/status/1892922843303678125


12,278 posted on 02/21/2025 7:00:54 AM PST by FtrPilot
[ Post Reply | Private Reply | To 12275 | View Replies]

To: PIF
Baba Yaga could certainly be made under license.

The U.S. Army's Concept of Operations (CONOPS) should be updated to include "drone warfare."

12,279 posted on 02/21/2025 7:16:12 AM PST by FtrPilot
[ Post Reply | Private Reply | To 12277 | View Replies]

To: PIF
... in exchange for the US withdrawing from NATO and from Europe. Russia would stretch from the Pacific to the Atlantic, from the Arctic to the Mediterranean.

The globalist Left is in a full-blown panic


12,280 posted on 02/21/2025 7:33:56 AM PST by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 50 | View Replies]


Navigation: use the links below to view more comments.
first previous 1-20 ... 12,241-12,26012,261-12,28012,281-12,300 ... 18,721-18,733 next last

Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.

Free Republic
Browse · Search
Bloggers & Personal
Topics · Post Article

FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson