Free Republic
Browse · Search
Bloggers & Personal
Topics · Post Article

Skip to comments.

How Terahertz Waves Tear Apart DNA (Technology to be used in NYC street scanners)
MIT Technology Review ^ | 10/30/2009 | arXiv blog

Posted on 01/18/2012 4:34:31 PM PST by CedarDave

Great things are expected of terahertz waves, the radiation that fills the slot in the electromagnetic spectrum between microwaves and the infrared. Terahertz waves pass through non-conducting materials such as clothes , paper, wood and brick and so cameras sensitive to them can peer inside envelopes, into living rooms and "frisk" people at distance.

The way terahertz waves are absorbed and emitted can also be used to determine the chemical composition of a material. And even though they don't travel far inside the body, there is great hope that the waves can be used to spot tumours near the surface of the skin.

~~snip~~

Alexandrov and co have created a model to investigate how THz fields interact with double-stranded DNA and what they've found is remarkable. They say that although the forces generated are tiny, resonant effects allow THz waves to unzip double-stranded DNA, creating bubbles in the double strand that could significantly interfere with processes such as gene expression and DNA replication. That's a jaw dropping conclusion.

(Excerpt) Read more at technologyreview.com ...


TOPICS: Health/Medicine; Science
KEYWORDS: banglist; fourthamendment; guns; newyork; secondamentment
Companion article to this thread:

NYPD, Feds Testing Gun-Scanning Technology, But Civil Liberties Groups Up In Arms

1 posted on 01/18/2012 4:34:40 PM PST by CedarDave
[ Post Reply | Private Reply | View Replies]

To: CedarDave

What does this MIT know? /s
Big Brother is here to keep us safe!


2 posted on 01/18/2012 4:39:05 PM PST by EEGator
[ Post Reply | Private Reply | To 1 | View Replies]

To: CedarDave

This theory has been tested I believe and was not supported. Not only that but it seems somewhat difficult to believe given that terahertz radiation appears naturally all around us. Yet that doesn’t seem to be a problem.


3 posted on 01/18/2012 4:45:31 PM PST by Brilliant
[ Post Reply | Private Reply | To 1 | View Replies]

To: Brilliant

I’ve got neutrinos in me brain.


4 posted on 01/18/2012 4:50:31 PM PST by cripplecreek (Stand with courage or shut up and do as you're told.)
[ Post Reply | Private Reply | To 3 | View Replies]

To: CedarDave

I studied this technology 15 years ago when it was popular research in Japan. They developed scanners using terahertz waves. The waves have some very unusual characteristics.

One question is, does the wave cause an increase in temperature at the cellular level? My question is, if temperature does increase, how does it impact enzymes which are temperature sensitive in performing their function as facilitators or inhibitors?

Let them try it on a box of bullets and see the impact upon the primers!


5 posted on 01/18/2012 5:13:59 PM PST by tired&retired
[ Post Reply | Private Reply | To 1 | View Replies]

To: CedarDave

Here is an excellent link on practical application.

http://www.agiltron.com/pdfs/thz%20imager%20specs.pdf

THz Camera Module
Uncooled, Low Cost, Handheld Solution for Terahertz Imaging

Applications
• Drug Development
• Explosives Detection
• Firefighting
• Food Monitoring
• Laser Beam Profiling
• Mail Inspection
• Manufacturing Process Control
• Medical Imaging
• Nondestructive Testing (NDT)
• Personnel Screening


6 posted on 01/18/2012 5:20:07 PM PST by tired&retired
[ Post Reply | Private Reply | To 1 | View Replies]

To: AdmSmith

pong


7 posted on 01/18/2012 5:28:38 PM PST by nuconvert ( Khomeini promised change too // Hail, Chairman O)
[ Post Reply | Private Reply | To 1 | View Replies]




Boop His Tiny Tail!

Before He Turns Into an Enormous Fire-Breathing Monster
Please Donate Monthly!


Sponsors will contribute $10
For each new monthly sign-up

8 posted on 01/18/2012 5:31:53 PM PST by TheOldLady (FReepmail me to get ON or OFF the ZOT LIGHTNING ping list)
[ Post Reply | Private Reply | View Replies]

To: CedarDave

A skin cancer generator? sure sounds like it


9 posted on 01/18/2012 5:44:11 PM PST by NonValueAdded (Limbaugh: Tim Tebow miracle: "He had atheists praying to God that he would lose.")
[ Post Reply | Private Reply | To 1 | View Replies]

To: CedarDave

No, the NYPD story is about passive waves naturally emitted from the body (think heat), while the story you posted is about active waves. Very different.


10 posted on 01/18/2012 5:44:41 PM PST by Kirkwood (Zombie Hunter)
[ Post Reply | Private Reply | To 1 | View Replies]

To: Kirkwood

Hmm... You appear to be correct in that observation.


11 posted on 01/18/2012 6:01:10 PM PST by CedarDave (Donna Brazile: "... we we believe that the weakest candidate ... [is] Mitt Romney.")
[ Post Reply | Private Reply | To 10 | View Replies]

To: CedarDave; neverdem
...although the forces generated are tiny, resonant effects allow THz waves to unzip double-stranded DNA, creating bubbles in the double strand that could significantly interfere with processes such as gene expression and DNA replication.

OMG!

12 posted on 01/18/2012 6:38:48 PM PST by GOPJ (GAS WAS $1.85 per gallon on the day Obama was Inaugurated! - - freeper Gaffer)
[ Post Reply | Private Reply | To 1 | View Replies]

To: CedarDave; GOPJ

Thanks for the post and the ping, respectively.


13 posted on 01/18/2012 8:05:04 PM PST by neverdem (Xin loi minh oi)
[ Post Reply | Private Reply | To 1 | View Replies]

To: nuconvert; CedarDave; neverdem
This is definitely not dangerous. There is no mechanism for any non-thermal effect for these very weak photons that can cause harm to us. Besides, we, like all objects on the earth are spreading THz waves, look at the frequency band:

from the Wikipedia article http://en.wikipedia.org/wiki/THz
14 posted on 01/19/2012 9:12:22 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 7 | View Replies]

To: TheOldLady; AdmSmith; AnonymousConservative; Berosus; bigheadfred; Bockscar; ColdOne; ...

http://www.youtube.com/watch?v=LN2xu4mDXMs

and for those of a different mind:

http://www.youtube.com/watch?v=jXRUk-UyDgw


15 posted on 01/19/2012 5:29:34 PM PST by SunkenCiv (FReep this FReepathon!)
[ Post Reply | Private Reply | To 8 | View Replies]

Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.

Free Republic
Browse · Search
Bloggers & Personal
Topics · Post Article

FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson