Free Republic
Browse · Search
News/Activism
Topics · Post Article

Skip to comments.

COP28 president says there is ‘no science’ behind demands for phase-out of fossil fuels
The Guardian ^ | Dec 3 | Damian Carrington and Ben Stockton

Posted on 12/03/2023 3:26:53 AM PST by RandFan

The president of Cop28, Sultan Al Jaber, has claimed there is “no science” indicating that a phase-out of fossil fuels is needed to restrict global heating to 1.5C, the Guardian and the Centre for Climate Reporting can reveal.

Al Jaber also said a phase-out of fossil fuels would not allow sustainable development “unless you want to take the world back into caves”.

The comments were “incredibly concerning” and “verging on climate denial”, scientists said, and they were at odds with the position of the UN secretary general, António Guterres.

Al Jaber made the comments in ill-tempered responses to questions from Mary Robinson, the chair of the Elders group and a former UN special envoy for climate change, during a live online event on 21 November. As well as running Cop28 in Dubai, Al Jaber is also the CEO of the United Arab Emirates’s state oil company, Adnoc, which many observers see as a serious conflict of interest.

More than 100 countries already support a phase-out of fossil fuels and whether the final Cop28 agreement calls for this or uses weaker language such as “phase-down” is one of the most fiercely fought issues at the summit and may be the key determinant of its success.

(Excerpt) Read more at theguardian.com ...


TOPICS: Miscellaneous; News/Current Events; United Kingdom
KEYWORDS: benstockton; climate; cop28; damiancarrington; ecoterrorism; ecoterrorists; energy; fuel; globalwarminghoax; greennewdeal; sultanaljaber; unitedkingdom
Navigation: use the links below to view more comments.
first previous 1-2021-34 last
To: RandFan

On one hand, I am not a big fan of fossil fuels because it profits do help the Islamists way too much.

On the other hand, I am almost equally (if not more) skeptical of the Climate Change crowd. I think most of them are Marxists whose real plan to achieve “sustainability” is to kill of billions of humans.

So....pick your poison.


21 posted on 12/03/2023 5:30:15 AM PST by rbg81
[ Post Reply | Private Reply | To 1 | View Replies]

To: Fireone

prison


22 posted on 12/03/2023 5:49:46 AM PST by joshua c (to disrupt the system, we must disrupt our lives, cut the cable tv)
[ Post Reply | Private Reply | To 16 | View Replies]

To: alloysteel

Three cheers for Tommy Gold!


23 posted on 12/03/2023 6:05:58 AM PST by NewHampshireDuo ( )
[ Post Reply | Private Reply | To 11 | View Replies]

To: MikelTackNailer

Carbon dioxide is a VERY small constituent of the total atmosphere of earth, some 400 parts per million, and is relatively heavy at ambient temperatures, sinking to the bottom of the air and quickly absorbed by the surface waters of the earth, and by living plants in the process of photosynthesis, creating carbohydrates and free oxygen as a byproduct. Without carbon dioxide, there could not be adequate quantities of oxygen regenerated into the atmosphere, and there would be a widespread die-back of most animal life. Of course, the decomposing corpses would give off considerable carbon dioxide, quickly restoring the balance of carbon dioxide to its equilibrium levels, which vary between maybe 300 parts per million, up to 1,000 or so parts per million.

Carbon dioxide, as a “greenhouse” gas, is vastly less important to heat absorption and retention than a highly variable constituent of the atmosphere, water vapor. The water molecule can exist simultaneously as a solid (ice), a liquid (water) and as a gas (water vapor or steam), at the so-called “triple point”, 32 degrees Fahrenheit or 0 degrees Centigrade. Carbon dioxide cannot, as it can exist only as a gas at normal sea-level conditions, but under extreme cooling, it becomes a solid, which sublimates directly from a solid to the gaseous state as it warms, with no intermediate liquid state except under extreme pressure.

Without the liquid state, carbon dioxide cannot retain the heat energy, or release it, under normal atmospheric conditions as they exist on earth. So its effect on warming or cooling of the atmosphere is very minimal. But water, which absorbs considerable heat energy as it passes from solid (ice) to liquid (water) and on into gas (water vapor), also gives up that energy as well, as the temperature decreases, eventually reverting back to the solid form. This is what moderates the temperature of the atmosphere, and by conduction, radiation, or condensation/vaporization, keeps the rest of the earth in a relatively narrow band of temperature, something carbon dioxide cannot do.


24 posted on 12/03/2023 6:51:00 AM PST by alloysteel (Most people slog through life without ever knowing the wonders of true insanity.)
[ Post Reply | Private Reply | To 15 | View Replies]

To: alloysteel

... and thus commenced the “War on Water”!


25 posted on 12/03/2023 7:09:55 AM PST by The Duke (Why do I think that the cynicism gene is going to be prevalent in future generations?)
[ Post Reply | Private Reply | To 24 | View Replies]

To: RandFan

Guterres is a commie moron


26 posted on 12/03/2023 7:50:16 AM PST by butlerweave
[ Post Reply | Private Reply | To 1 | View Replies]

To: RandFan

27 posted on 12/03/2023 7:51:36 AM PST by Chode (there is no fall back position, there's no rally point, there is no LZ... we're on our own. #FJB)
[ Post Reply | Private Reply | To 1 | View Replies]

To: Tell It Right

Thanks, the figure is from: Hot weather and climate change – a mountain from a molehill?

Climate changes over hundreds and thousands of years. Data from ice cores show several periods during the last 10,000 years that were warmer than today, including the Roman Climate Optimum at the height of the Roman Empire and the Medieval Warm Period, when the Vikings settled southwest Greenland. The warm and cool eras since the last ice age were due to natural climate cycles, not greenhouse gas emissions. The “on record” period that NOAA references is only a tiny part of the climatic picture.

https://wattsupwiththat.com/2013/07/03/hot-weather-and-climate-change-a-mountain-from-a-molehill/


28 posted on 12/03/2023 7:57:10 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 5 | View Replies]

To: alloysteel
Thank you very much. I saw a bit on "60 Minutes" about a billion dollar Nordic complex made to pump carbon dioxide from the atmosphere deep into the Earth's crust, supposedly saving us from a temperature rise of half a degree in our life-times. As if core samples and such haven't proved alternating hot and cold cycles are a natural cycle. What's their term for "huge scam"?

All of this crap is a manufactured panic designed to goad the less-intelligent masses into complying with agendas that increase the power and wealth of the self-appointed elites at the expense of everyone else they deem beneath them.

All these super-villains with nary a James Bond to deal with them. I'd do it but I got old and broken down before seeing it. LOL

29 posted on 12/03/2023 8:15:07 AM PST by MikelTackNailer (What should we hang from the branches this holiday season?)
[ Post Reply | Private Reply | To 24 | View Replies]

To: alloysteel

I just copied and pasted this into my notes on my phone so I can use it whenever posting about “climate change”. Thank you! More people need to understand this!


30 posted on 12/03/2023 8:29:29 AM PST by Mama Shawna
[ Post Reply | Private Reply | To 11 | View Replies]

To: alloysteel

There is no such thig as “fossil fuel”, that is a convenient fiction used to make people believe that the supply of hydrocarbon fuels extracted from the earth is a finite amount.

News alert. The deep crust of earth at the boundary of the rocky crust with the molten deeper layers, continues to generate new quantities of various hydrocarbons in that hellish zone known as the Mohorovičić discontinuity. Supercritical carbon dioxide acts as a powerful solvent, and a reactant in the millions of complex chemical reactions with what is also supercritical steam, water vapor compressed back into a liquid, forming new hydrocarbon compounds known as kerogens. These compounds are then forced into the rocky layers above, where they become reservoirs of crude oil, or refilling “dry” reservoirs that have been abandoned as oil wells years ago. Together with these kerogens, huge quantities of natural gas, composed of methane, ethane, propane and butane, also accumulate, and recharge the crevices and cavities within the rocky crust, to be released by “fracking”, a process that extracts this important energy source.

So the earth’s crust is generating NEW hydrocarbons, and thus meets the definition of a “renewable” energy source.


Repeat LOUD and OFTEN...........

It takes the truth to overcome lies.


31 posted on 12/03/2023 8:33:57 AM PST by PeterPrinciple (Thinking Caps are no longer being issued but there must be a warehouse full of them somewhere.)
[ Post Reply | Private Reply | To 11 | View Replies]

To: maddog55
In the meantime I’ll continue to drive my 9.2mpg truck to help deplete fossil fuels.

You go, guy...just don't be obnoxious with a loud non-muffler. I have to constantly monitor the gas stations for the lowest prices because of "I Did That" ass-hat's directive to help destroy America.

Hey Elon Musk - we love your brilliance but either perfect electric cars or admit it's a failure and provide a better option.

32 posted on 12/03/2023 8:48:14 AM PST by MikelTackNailer (What should we hang from the branches this holiday season?)
[ Post Reply | Private Reply | To 12 | View Replies]

To: RandFan

I love it!

Affirmative Action and “inclusivity” bites the propagandists in the ass!

There’s no doubt in my mind that they made this guy their president because he’s Arab who could be used to showcase how inclusive they are.


33 posted on 12/03/2023 9:39:46 AM PST by aquila48 (Do not let them make you "care" ! Guilting you is how they control you. )
[ Post Reply | Private Reply | To 1 | View Replies]

To: MikelTackNailer

I’ve got a flowmaster 10 muffler. Sounds nice ideling butnot loud... I like hearing my vehicles which is another reason I’d never own an EV.


34 posted on 12/03/2023 11:06:19 AM PST by maddog55 (The only thing systemic in America is the left's hatred of it!)
[ Post Reply | Private Reply | To 32 | View Replies]


Navigation: use the links below to view more comments.
first previous 1-2021-34 last

Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.

Free Republic
Browse · Search
News/Activism
Topics · Post Article

FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson