Free Republic
Browse · Search
News/Activism
Topics · Post Article

To: AmericanInTokyo; baclava; BeauBo; Bruce Campbells Chin; Chainmail; Covenantor; Cronos; datura; ...
A series of pictures

https://runews.biz/vladimir-putin-umer-stranoj-upravlyaet-dvojnik-dlya-rossii-tolko-cherez-vpn/
The article above claims that the old Putin is no more and that he is replaced.

and this

What is the result if one of the earlier pictures is run through an “aging software?

1,176 posted on 06/01/2022 12:53:17 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 1163 | View Replies ]


To: AdmSmith
FYI, according to https://lookup.icann.org/en/lookup, https://runews.biz was created on 2021-05-06 16:42:08 UTC. Most of the articles are authored by "RuNews", a clue that this website is a one man show. There are lots of bloggers who call themselves news sites, by coping real news sites and giving one side or the other their daily confirmation bias to get clicks and ad revenue.
1,179 posted on 06/01/2022 2:08:45 AM PDT by Widget Jr
[ Post Reply | Private Reply | To 1176 | View Replies ]

To: AdmSmith

Article translated:

RuNews
VLADIMIR PUTIN IS DEAD. THE COUNTRY IS CONTROLLED BY A DOUBLE for Russia only via VPN
Posted by: 29.05.2022 : In the World Author: RuNews

Russian President Vladimir Putin is long dead. The Russian Federation is controlled by the security forces using Putin’s doubles.

How Putin’s face has changed in 15 years. See portraits of Vladimir Vladimirovich to see how his face has changed since 1998. Who will find different faces, write in the comments. For convenience, I have numbered the portraits. Let’s go, the test for the most attentive begins! You can show off your ability to distinguish people from a photo. Not all of them can. Check yourself for attention. Photo resolution 3073 x 2195 pixels.

I’ll try in order. A couple of years ago I read an article in the German Spiegel that in 2006 one of the leading German oncological centers was consulted by the Moscow Central Clinical Hospital regarding a biopsy of an anonymous patient. The Germans conducted an analysis, established the form of cancer and gave the patient a maximum of 6 months. They thanked him from Russia, but they refused treatment, moreover, after a while the German doctors were informed that the patient was completely healthy.

I think there is no need to explain that in any self-respecting state there are “genetic portraits” of the most significant people (hairs, skin particles and other biomaterial are used for this, which a living person inevitably leaves, for example, during foreign visits). in the West DNA-portrait” of Putin , so the Germans figured out who they were talking about even without the Kremlin’s instructions. And at the latest by mid-2007, the patient was supposed to die.

Well, now let’s see how events develop further. Since 2007, Lyudmila Putina - she no longer participates in receptions, foreign trips. No clear reasons were given. In 2007, the surprising idea of ​​Putin’s refusal of a third term in favor of Medvedev appears. Allegedly, all this is due to the Constitution, which prohibits the third term.

But, firstly, they put it on the Constitution (for example, it prescribes to elect governors, and they have been appointed since 2004), and secondly, the Constitution does not write three terms in a row, but three terms in general, i.e. The current term of “Putin” is generally unconstitutional.

“Putin” goes into the shadows, becoming prime minister, sitting in the country without getting out, leaving only for the CIS and regions of Russia. Rapid and inexplicable changes are taking place in the appearance of “Putin”, which at first are not commented on in any way, but when it becomes impossible not to notice them, a version of unsuccessful plastic surgery and Botox is thrown up. “Putin” ceases to recognize old acquaintances (for example, colleagues from the KGB), no longer understands German without translation, ties up with sports (for example, skiing), often speaks out of place, gets confused in the facts of his own biography, and at the same time happens in different places. In addition, there are several different “Putins”, quite different from each other.

From all this, I conclude that the real Putin V.V. most likely he either died or was incapacitated over the past 5-6 years. Initially, a soft transition of power to Medvedev was planned, but he showed his absolute incompetence, so he had to reincarnate the image of Pu, since modern technologies allow this. For example, in the 90s, TV showed video reports of EBN’s trips and meetings while he was on a drip in the hospital for months.

This explains the strangeness with divorce. Indeed, all dogs are traditionally hanged on former leaders in Russia, and in order to protect the spouse from future troubles, she was “divorced” ahead of time - now she and the children have nothing to do with “Putin”.

Mr. Putin has been in the public eye since 1999, although the lesser public has seen him before, when he worked in Mr. Sobchak’s administration. Therefore, in general, the period of video coverage of the GDP (that is, the availability of photographic documents for this person) covers almost 20 years. Having on hand photographs of a person for 20 years, it is not very difficult to detect a substitution. On the site, with photographs, four completely different people are depicted.

They have a different skull shape (the width of the eye sockets, the shape of the chin, the shape of the zygomatic bones), they have a different volume of soft tissues and cartilage of the face (wings of the nose, lips, cheeks), they have different hair boundaries (scalp and eyebrows), they have different eye color, they have a different look expression. What can I say just about photos, when on the official websites of the government, there are photos of clearly different people: A good thing is an Internet search engine. By request “putin photo” you can get 100,500 photos.

Here is Putin V.V. with Sobchak. But comparing Putin with Sobchak is not interesting. It is much more interesting to compare Putin with Putin. And if you level the portraits in height and assemble them in pairs for convenience, then it’s a most entertaining sight: In the last photo on the left is V.V. Putin takes the presidential oath in 2000, on the right - now shed a tear from the results of the vote in 2012. And you: “Russia without Putin”, “ Russia without Putin.

Yes, looking at such paired photos, the first thought is “The king is not real!”. You can argue indefinitely about the shape of the ears, think about the properties of Botox and the effects of hormone therapy. But something tells me that Pelevin in his “Generation P” was not so wrong and the media are able to inspire us with anything; there is a president, there is no president, what the hell is the difference - the main thing is the picture. Moreover, just like Pelevin, the question of who gives the order to the media is open. The members of his family are long gone. And the pictures are pretty cool, yes.

Photos and videos provided by the official Kremlin after 2000 show at least four people, each of whom resembles Vladimir Putin in one way or another. As a maximum (and it is most likely) there are generally six completely different people who are passed off as Putin.
Russia is being destroyed by Putin’s doubles


1,183 posted on 06/01/2022 3:30:51 AM PDT by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 1176 | View Replies ]

To: AdmSmith

I think it’s more likely that a double may have been photographed once or twice. But I think we’re dealing with the same Putin. (tho his mental faculties may have changed)


1,186 posted on 06/01/2022 4:29:12 AM PDT by nuconvert ( Warning: Accused of being a radical militarist. Approach with caution.)
[ Post Reply | Private Reply | To 1176 | View Replies ]

To: AdmSmith

SJWs always *PROJECT*.

Therefore should one conclude that Biden has been replaced?


1,189 posted on 06/01/2022 6:38:32 AM PDT by grey_whiskers (The opinions are solely those of the author and are subject to change with out notice.)
[ Post Reply | Private Reply | To 1176 | View Replies ]

Free Republic
Browse · Search
News/Activism
Topics · Post Article


FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson