Free Republic
Browse · Search
News/Activism
Topics · Post Article

Skip to comments.

Coronavirus Live Update Feb 3rd, 2020 (Agenda Free TV)
Agenda free TV ^

Posted on 02/03/2020 2:12:38 PM PST by janetjanet998

There are currently 19,843 confirmed cases worldwide, including 426 fatalities


TOPICS: News/Current Events
KEYWORDS: 2019ncov; bringoutyourdead; coronavirus
Navigation: use the links below to view more comments.
first previous 1-20 ... 101-120121-140141-160 ... 241-251 next last
To: blueplum

https://www.facebook.com/TravisAirForceBase/posts/2796030810476876


121 posted on 02/03/2020 7:45:30 PM PST by blueplum ( ("...this moment is your moment: it belongs to you... " President Donald J. Trump, Jan 20, 2017))
[ Post Reply | Private Reply | To 105 | View Replies]

To: blueplum

marker


122 posted on 02/03/2020 7:53:28 PM PST by abigkahuna (How can you be at two places at once when you are nowhere at all?)
[ Post Reply | Private Reply | To 121 | View Replies]

To: RummyChick

The first article talking about that was the South China Morning Post last weekend, about an asymptomatic 10-year-old whose family was infected.
Later discussion, and other articles, indicate ground-glass is a picturesque description of the appearance of pneumonia on a chest X-ray.


123 posted on 02/03/2020 8:56:55 PM PST by grey_whiskers (The opinions are solely those of the author and are subject to change with out notice.)
[ Post Reply | Private Reply | To 38 | View Replies]

To: 444Flyer

I’ll pass it along. Thanks.


124 posted on 02/03/2020 8:59:02 PM PST by Myrddin
[ Post Reply | Private Reply | To 120 | View Replies]

To: blueplum

Canada flight UPDATE Feb 3:
Canada announced late on Sunday that it had chartered an aircraft to evacuate 304 citizens from the city of Wuhan in the Hubei province.
All of the visas for crews have been approved, but the Canada is awaiting final approvals from Beijing, officials said on Monday.
https://www.theguardian.com/world/2020/feb/03/hundreds-canadians-await-evacuation-flight-wuhan-coronavirus-outbreak


125 posted on 02/03/2020 9:28:31 PM PST by blueplum ( ("...this moment is your moment: it belongs to you... " President Donald J. Trump, Jan 20, 2017))
[ Post Reply | Private Reply | To 105 | View Replies]

To: janetjanet998
Cross post from other thread on subject of immunity...

If you recover from the original virus are you then immune? At least if there is no mutation?

In the case of some viruses the body doesn't produce antibodies for very long...months...

After being infected with a norovirus, people have temporary immune protection, which usually lasts no more than 14 weeks.

In other cases the virus itself destroys the individual's immunity

During the acute phase of infection, measles induces immune suppression through a process called immune amnesia.

And antibodies are not always 100% effective. For these reasons people can be reinfected even without mutation.

126 posted on 02/03/2020 9:44:04 PM PST by steve86 (Prophecies of Maelmhaedhoc O'Morgair (Latin form: Malachy))
[ Post Reply | Private Reply | To 1 | View Replies]

To: LilFarmer

related:
https://encyclopedic.co.uk/2020/02/03/wuhan-turns-to-social-media-to-vent-anger-at-coronavirus-response/

In China, it’s roses and champagne on the state newscasts. It is rumored that China is blocking VPNs in further attempts to prevent news from coming out. Internal media is still afraid to say anything negative - it’s oh, look at the new hospital, look at all the unity, hard workers. Squirrel, Squirrel !!


127 posted on 02/03/2020 9:55:56 PM PST by blueplum ( ("...this moment is your moment: it belongs to you... " President Donald J. Trump, Jan 20, 2017))
[ Post Reply | Private Reply | To 87 | View Replies]

To: janetjanet998

Feb 3; Blocking the coronavirus: Hong Kong medical workers go on strike to demand closure of border with China

The semi-autonomous city’s local medical union announced that 300 of the strikers are doctors and another 900 are nurses. Those figures are expected to balloon on Tuesday, as the employees alliance expects 9,000 union members to participate in the strike, if Hong Kong Chief Executive Carrie Lam continues to allow entry to Hong Kong from the mainland.

https://www.washingtonexaminer.com/policy/defense-national-security/blocking-the-coronavirus-hong-kong-medical-workers-go-on-strike-to-demand-closure-of-border-with-china


128 posted on 02/03/2020 10:02:23 PM PST by blueplum ( ("...this moment is your moment: it belongs to you... " President Donald J. Trump, Jan 20, 2017))
[ Post Reply | Private Reply | To 1 | View Replies]

To: blueplum

and just to show that yes, China is badmouthing the USA- (squirrel ! squirrel !):

““The U.S. government hasn’t provided any substantive assistance to us, but it was the first to evacuate personnel from its consulate in Wuhan, the first to suggest partial withdrawal of its embassy staff, and the first to impose a travel ban on Chinese travelers,” Chinese Foreign Ministry spokeswoman Hua Chunying told reporters on Monday. “What it has done could only create and spread fear, which is a very bad example.” “

(same WE link above)


129 posted on 02/03/2020 10:04:18 PM PST by blueplum ( ("...this moment is your moment: it belongs to you... " President Donald J. Trump, Jan 20, 2017))
[ Post Reply | Private Reply | To 128 | View Replies]

To: blueplum; grey_whiskers; Black Agnes; janetjanet998

thanks grey_whiskers, Pulling you over to this thread for a sec - more on ages.

First print account of an alleged uninfected newborn:
note: This is from RT

‘The Harbin Municipal Health Commission made the announcement on Monday, after the woman gave birth to a healthy baby girl weighing 3.05kgs (6.7 lbs) on January 30. The mother and daughter were kept in quarantine...both are said to be in stable condition.
The woman presented herself to the hospital at 38 weeks pregnant with a high fever...the decision was taken to induce birth and deliver the baby via caesarean section....
The health commission said the child registered a remarkable Apgar score of 10, with seven usually indicating a very healthy child.
The baby has since tested negative for coronavirus on two separate occasions.

https://encyclopedic.co.uk/2020/02/03/coronavirus-infected-woman-gives-birth-to-perfectly-healthy-baby-in-china/


130 posted on 02/03/2020 10:15:47 PM PST by blueplum ( ("...this moment is your moment: it belongs to you... " President Donald J. Trump, Jan 20, 2017))
[ Post Reply | Private Reply | To 129 | View Replies]

To: blueplum

“first to impose a travel ban on Chinese travelers”

Provably false. Israel, among others, did that first.


131 posted on 02/03/2020 10:20:19 PM PST by Black Agnes
[ Post Reply | Private Reply | To 129 | View Replies]

To: blueplum

more ages:
Australia - 60yo man; 60yo woman
Cambodia - 60yo man, slight symptoms
Canada - 4th case - 20’s female, 1st test negative; 2nd test ‘weakly positive’
Finland - 32yo woman
France - 5th case, dau of existing case-80yo woman. (assume 50’s?) 6th case: French doctor in contact w/patient ‘in Asia’
Germany - child of existing case- 33-yo male; 7 days to symptoms (assume toddler?)
Hong Kong - death - 39yo man, visited Wuhan 2 days - train travel
India - university student Wuhan (assume 20’s)
Italy - man/woman couple, traveled thru Rome/Italy
Japan - SUPERCARRIER - male 30’s; rescue flight evacuee
Malaysia - 4yo and 52yo man
Nepal - 38yo male, PhD student Wuhan
Russia - 2 cases: 1)Western Siberia, borders Kazak and 2) Zabaikalsky region, borders China
Sweden: woman
Taiwan: 9th case: man, 40’s (note: export of face masks suspended by Taiwan to preserve supply)
Thailand: 2 are Thai nationals, one is male, taxi driver (assume 40’s-50’s); 4 of 5 new cases are Wuhan nationals (assume 2 male;2 female)
UK: 2 cases: members of same family (2 females?) (assume 20s/40’s?)
Vietnam: latest case: woman, returned to Vietnam Jan 17; tested Jan 31, confirmed today
https://abc17news.com/news/national-world/2020/02/04/this-is-where-wuhan-coronavirus-cases-have-been-confirmed-worldwide/


132 posted on 02/03/2020 11:20:40 PM PST by blueplum ( ("...this moment is your moment: it belongs to you... " President Donald J. Trump, Jan 20, 2017))
[ Post Reply | Private Reply | To 130 | View Replies]

To: Black Agnes

recall that floating petri dish?:

Ship quarantined. Passengers and crew to stay on board until at least Tuesday night.

https://www.reuters.com/article/us-china-health-japan-ship-idCAKBN1ZY0BP


133 posted on 02/03/2020 11:27:06 PM PST by blueplum ( ("...this moment is your moment: it belongs to you... " President Donald J. Trump, Jan 20, 2017))
[ Post Reply | Private Reply | To 131 | View Replies]

To: janetjanet998

Xi Jinping was filmed dry-coughing today.

https://twitter.com/WBYeats1865/status/1222815892028788737


134 posted on 02/04/2020 12:25:43 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 1 | View Replies]

To: AdmSmith; Dog

If that is really from 3 February, someone is likely sending out a signal to the Chinese people.


135 posted on 02/04/2020 2:39:15 AM PST by Cap Huff (1776 - Washington fought for us. Since 2016 Washington has fought against us . . .)
[ Post Reply | Private Reply | To 134 | View Replies]

To: Paul R.

Saw this today, this guy is estimating CFR the same way I was trying to. He has an interesting chart, but I don’t know how to post pics.

https://www.facebook.com/linton.j.norrish/posts/10220983446238797


136 posted on 02/04/2020 3:31:37 AM PST by LilFarmer
[ Post Reply | Private Reply | To 116 | View Replies]

To: LilFarmer

https://video.foxbusiness.com/v/6129461482001/#sp=show-clips

“What is it like to be quarantined in a China? Feb. 04, 2020 - 8:12 - The Wall Street Journal reporter Stephanie Yang discusses her being quarantined at a hotel in Xiangyang, China over fears of coronavirus spreading and whether the Chinese government can be trusted.”

‘Right, uh, yeah.” Another reporter who slept through Journalism 101.


137 posted on 02/04/2020 4:04:44 AM PST by bgill
[ Post Reply | Private Reply | To 136 | View Replies]

To: blueplum

I don’t like the idea of them bringing it in with them but why are they planning these flights so late in the game? Why not have them hop a commercial flight out last week or 10 days ago? Sorry, but at this time, if you’re that dumb to still be there, then stay.


138 posted on 02/04/2020 4:08:27 AM PST by bgill
[ Post Reply | Private Reply | To 105 | View Replies]

To: hardspunned

https://www.ksat.com/news/local/2020/02/01/officials-sas-lackland-air-force-base-will-serve-as-potential-quarantine-zone-for-those-infected-with-coronavirus/

The State Dept. is going to hold townhalls this week from concerned citizens. Well, that’s nice and all but a week too late.

http://af.dodlodging.net/propertys/JBSA-—Lackland-Kelly I can’t seem to get in to check for availabitiy dates for Lackland’s Gateway Inn and the Gateway Villa where they’ll be staying. Perhaps someone else can check for dates and we’ll know when they arrive/d and the length of stay.


139 posted on 02/04/2020 4:18:25 AM PST by bgill
[ Post Reply | Private Reply | To 5 | View Replies]

To: Magic Fingers; Mr Ramsbotham

Has anyone checked for signs of life in those houses they boarded up?


140 posted on 02/04/2020 4:20:29 AM PST by bgill
[ Post Reply | Private Reply | To 13 | View Replies]


Navigation: use the links below to view more comments.
first previous 1-20 ... 101-120121-140141-160 ... 241-251 next last

Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.

Free Republic
Browse · Search
News/Activism
Topics · Post Article

FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson