Free Republic
Browse · Search
News/Activism
Topics · Post Article

Skip to comments.

Australian scientists grow copy of coronavirus in lab,called 'significant breakthrough'
FOX ^ | 1-29-20

Posted on 01/29/2020 6:30:52 AM PST by nuconvert

Australian scientists said Tuesday that they successfully developed a lab-grown version of the coronavirus-- the first to create a version outside of China-- which is seen as a "significant breakthrough."

Researchers from the Peter Doherty Institute for Infection and Immunity in Melbourne will share their discovery with the World Health Organization (WHO) in the hope it could improve efforts to treat and diagnose the virus, which has killed 132 people and infected nearly 6,000 in China and abroad.

The Doherty Institute's Virus Identification Laboratory Head Dr. Julian Druce said having the real virus could be used as "control material" for testing while describing it as a "game-changer," according to the Telegraph.

(Excerpt) Read more at foxnews.com ...


TOPICS: Culture/Society; Extended News; News/Current Events
KEYWORDS: 2019ncov; australia; china; coronavirus; health; labgrown; medicine; who
Navigation: use the links below to view more comments.
first 1-2021-4041-43 next last

1 posted on 01/29/2020 6:30:52 AM PST by nuconvert
[ Post Reply | Private Reply | View Replies]

To: nuconvert

Let the high throughput screening commence.


2 posted on 01/29/2020 6:32:34 AM PST by Black Agnes
[ Post Reply | Private Reply | To 1 | View Replies]

To: AdmSmith

pong


3 posted on 01/29/2020 6:41:17 AM PST by nuconvert ( Warning: Accused of being a radical militarist. Approach with caution.)
[ Post Reply | Private Reply | To 1 | View Replies]

To: nuconvert



4 posted on 01/29/2020 6:41:31 AM PST by RummyChick
[ Post Reply | Private Reply | To 1 | View Replies]

To: RummyChick

Wow


5 posted on 01/29/2020 6:43:56 AM PST by central_va (I won't be reconstructed and I do not give a damn.)
[ Post Reply | Private Reply | To 4 | View Replies]

To: RummyChick

Lol


6 posted on 01/29/2020 6:44:18 AM PST by nuconvert ( Warning: Accused of being a radical militarist. Approach with caution.)
[ Post Reply | Private Reply | To 4 | View Replies]

To: nuconvert

I wonder if they can determine if is bio weapon that got loose from a sample.


7 posted on 01/29/2020 6:47:28 AM PST by DEPcom
[ Post Reply | Private Reply | To 1 | View Replies]

To: nuconvert

that one guy in the airport photo looks like he saran wrapped his eyes


8 posted on 01/29/2020 6:51:29 AM PST by RummyChick
[ Post Reply | Private Reply | To 6 | View Replies]

To: RummyChick

Necessity is the mother of invention.

In this case, the father is the plastics industry.


9 posted on 01/29/2020 7:03:24 AM PST by UCANSEE2 (Lost my tagline on Flight MH370. Sorry for the inconvenience.)
[ Post Reply | Private Reply | To 4 | View Replies]

To: UCANSEE2

The first photo is funny to me. You have one guy with a bottle over his entire head, the other with a helmet with the visor lifted up and no mask..and a vendor who could care less and has no protection at all. She just wants the money


10 posted on 01/29/2020 7:07:38 AM PST by RummyChick
[ Post Reply | Private Reply | To 9 | View Replies]

To: DEPcom

It is not a biological warfare agent. For info see this https://www.freerepublic.com/tag/by:admsmith/index?tab=comments;brevity=full;options=no-change


11 posted on 01/29/2020 7:09:09 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 7 | View Replies]

To: AdmSmith

see what??? What is your source that the virus from a patient has been sequenced and it is known for sure it is not a bioweapon.

We already know this exact type of thing was built in a lab at Chapel Hill..even if it isn’t this specific one.


12 posted on 01/29/2020 7:13:21 AM PST by RummyChick
[ Post Reply | Private Reply | To 11 | View Replies]

To: nuconvert; neverdem; ProtectOurFreedom; Mother Abigail; EBH; vetvetdoug; Smokin' Joe; Global2010; ..
Bring Out Your Dead

Post to me or FReep mail to be on/off the Bring Out Your Dead ping list.

The purpose of the “Bring Out Your Dead” ping list (formerly the “Ebola” ping list) is very early warning of emerging pandemics, as such it has a high false positive rate.

So far the false positive rate is 100%.

At some point we may well have a high mortality pandemic, and likely as not the “Bring Out Your Dead” threads will miss the beginning entirely.

*sigh* Such is life, and death...

If a quarantine saves just one child's life, it's worth it.

13 posted on 01/29/2020 7:16:51 AM PST by null and void (The government wants to disarm us after 243 yrs 'cuz they plan to do things we would shoot them for!)
[ Post Reply | Private Reply | To 1 | View Replies]

To: nuconvert

Their top-flight scientists must have been working instead of being on TV networks telling the public to wash their hands.


14 posted on 01/29/2020 7:17:21 AM PST by txrefugee
[ Post Reply | Private Reply | To 1 | View Replies]

To: RummyChick

You may read the articles that are linked and study the RNA sequences together with the phylogenetic trees that are published, then you know that is not a biological warfare agent gone wild.


15 posted on 01/29/2020 7:21:19 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 12 | View Replies]

To: RummyChick

Admitting it is a bioweapon without absolute proof, kicks it over the WMD threshold.

According to US doctrine, a WMD is a WMD is a WMD. Under this doctrine, any hostile use of any WMD can trigger a full nuclear response.

Let’s not go there until and unless we are certain they’ve deliberately crossed that threshold.


16 posted on 01/29/2020 7:22:44 AM PST by null and void (The government wants to disarm us after 243 yrs 'cuz they plan to do things we would shoot them for!)
[ Post Reply | Private Reply | To 12 | View Replies]

To: AdmSmith

GIve me a link that says they know for sure it is not man made.

It can be man made. Chapel Hill proved it.

I don’t think they know yet on this one.


17 posted on 01/29/2020 7:26:19 AM PST by RummyChick
[ Post Reply | Private Reply | To 15 | View Replies]

To: RummyChick

Just read the links in my posts and if you need more background this is a good start: https://www.youtube.com/watch?v=svlKm4S1M3Y


18 posted on 01/29/2020 7:30:19 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 17 | View Replies]

To: AdmSmith

No, I don’t want to read all of your links. Provide the source that says they know for sure it is not man made. Either you have one or you dont

Btw, here is one way back when concerning SARS. more than likely we are going to end up seeing the same thing with this one.

https://www.chinadaily.com.cn/english/doc/2004-07/02/content_344755.htm


19 posted on 01/29/2020 7:33:55 AM PST by RummyChick
[ Post Reply | Private Reply | To 18 | View Replies]

To: null and void

I think we’re somewhere around 65 million abortions in the U.S. since 1973.


20 posted on 01/29/2020 7:34:31 AM PST by 3boysdad (The very elect.)
[ Post Reply | Private Reply | To 13 | View Replies]


Navigation: use the links below to view more comments.
first 1-2021-4041-43 next last

Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.

Free Republic
Browse · Search
News/Activism
Topics · Post Article

FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson