Free Republic
Browse · Search
News/Activism
Topics · Post Article

Skip to comments.

Putin Calls for a 'Revival' of Islamic Education in Russia
The Moscow Times ^ | Jan 25, 2018 | Yegor Aleyev

Posted on 01/26/2018 12:31:48 PM PST by GoldenState_Rose

President Vladimir Putin has promised government backing for Islamic religious education in Russia, in a bid to stave extremism and cater to Russia’s large Muslim community.

Up to 20 million Muslims make up Russia’s second-largest religious minority. Thousands of young radicalized Russians have travelled to Iraq and Syria to join jihadist fighters in recent years, making the country the largest source of foreign fighters in the war-torn region.

At a meeting with Islamic religious figures on Wednesday, Russia’s president pledged “undoubted support” for a "revival of Islamic education in Russia," the state-run TASS news agency reported.

“Traditional Islam is an integral part of the Russian cultural code, and the Muslim Ummah [community], without any doubt, is a very important component of the multinational Russian people,” he said.

(Excerpt) Read more at themoscowtimes.com ...


TOPICS: Culture/Society; Israel; News/Current Events; Russia; Syria; War on Terror
KEYWORDS: asia; assad; chechens; chechnya; communism; dagestan; education; erdogan; fascism; idlib; iran; isis; islam; israel; jerusalem; jihad; jihadism; kadyrov; kazan; kurdistan; letshavejerusalem; muslims; nuclear; pootypoot; putin; putinislam; putinsbuttboys; putinworshippers; receptayyiperdogan; russia; russiaislam; russianaggression; syria; tatars; tatarstan; terrorism; turkey; ukraine; vladtheimploder; waronterror; zottherussiantrolls
Navigation: use the links below to view more comments.
first previous 1-2021-37 last
To: rrrod

I don’t mind Russians killing muzzies.....


21 posted on 01/26/2018 1:35:18 PM PST by july4thfreedomfoundation (SCHLONGED: How Donald Trump Beat My Lying, Marxist Ass and Went On to Win the November Election. HRC)
[ Post Reply | Private Reply | To 11 | View Replies]

To: Paladin2

Indeed. The Islamic conquest of the Christian west is well underway. All too well underway. And with a few exceptions the western nations are being sold out to the Muslim conquest. It’s very sad. Tragic


22 posted on 01/26/2018 1:57:00 PM PST by faithhopecharity ("Politicans aren't born, they're excreted." -Marcus Tillius Cicero (3 BCE))
[ Post Reply | Private Reply | To 7 | View Replies]

To: july4thfreedomfoundation

Enjoy!!!!


23 posted on 01/26/2018 2:18:44 PM PST by rrrod (just an old guy with a gun in his pocke)
[ Post Reply | Private Reply | To 21 | View Replies]

To: rrrod

That makes no sense. Russia is our natural ally against Islam. Islam intends to destroy everything that is not Islam. I’ll take the Russians any day over bloodthirsty Muslims.


24 posted on 01/26/2018 4:04:41 PM PST by Pining_4_TX (For they sow the wind, and they shall reap the whirlwind. ~ Hosea 8:7)
[ Post Reply | Private Reply | To 11 | View Replies]

To: GoldenState_Rose; PGR88

I’ve said it before, Chechnya is way down there in Southern Russia, maybe Ossetia is too. Maybe they should just let them go since their such troubled spots. Really, Russia is like the size of 3 United States but those two areas don’t seem too big. I’m sure the ROC is there, so I do realize it is not a simple matter. I’ve been corrected about this before too, people say, then you have an Islamic Republic on your footsteps. That may well be so.


25 posted on 01/26/2018 4:35:05 PM PST by BeadCounter
[ Post Reply | Private Reply | To 1 | View Replies]

To: BeadCounter

I’ve read things like “Russia’s military will soon be majority Russian”; but really, if some of these areas have majority Muslim populations and that is where a good portion of Russia’s 20,000,000 Muslims are, one could conceivably let it go.

By the way, I think it’s a longstanding tradition over there, to embrace the diversity of religion including the Jewish faith too. They’ve got their strongman, Kadyrov in Chechnya, maybe they figure they can to an extent control things with their own favored rulers in power.


26 posted on 01/26/2018 4:39:39 PM PST by BeadCounter
[ Post Reply | Private Reply | To 25 | View Replies]

To: inchworm

You miss the point. It is better to have madrasses within the network of public schools with substantial control over their curriculum.
Currently these schools are run by the invited Saudi clerics as they please.


27 posted on 01/26/2018 11:43:21 PM PST by NorseViking
[ Post Reply | Private Reply | To 19 | View Replies]

To: GoldenState_Rose

Moslems comprise between 10% (Pew) and 15% (RT) of Russia’s population, which is a higher % than any country in Europe (even France). The Russians are screwed bigly on this front, longterm. But Putin doesn’t give a rip about longterm. He just wants to hold onto power for as long as he possible can with as little trouble from the ever-increasing Muzzie pop. as possible.


28 posted on 01/27/2018 12:23:56 PM PST by Mr. Mojo (There are two types of people in this world -- those with loaded guns, and those who dig.)
[ Post Reply | Private Reply | To 1 | View Replies]

To: AdmSmith; AnonymousConservative; Berosus; Bockscar; cardinal4; ColdOne; Convert from ECUSA; ...
Thanks GoldenState_Rose.

29 posted on 01/27/2018 12:33:43 PM PST by SunkenCiv (www.tapatalk.com/groups/godsgravesglyphs/, forum.darwincentral.org, www.gopbriefingroom.com)
[ Post Reply | Private Reply | View Replies]

To: Tailback

Aussie Imam makes shocking confessions about Islam

https://www.youtube.com/watch?v=ElY8sRu9Hi0


30 posted on 01/27/2018 2:46:04 PM PST by Fred Nerks (fair dinkum!)
[ Post Reply | Private Reply | To 17 | View Replies]

To: Gene Eric
"President Vladimir Putin has promised government backing for Islamic religious education in Russia."

He's gone completely out of his mind...!

31 posted on 01/27/2018 2:48:18 PM PST by unread (Joe McCarthy was right.......)
[ Post Reply | Private Reply | To 2 | View Replies]

To: Fred Nerks

Thanks for posting that. I got about 25 minutes in and had to do other stuff. I’ll watch the rest later. Very informative.


32 posted on 01/27/2018 6:56:24 PM PST by Tailback
[ Post Reply | Private Reply | To 30 | View Replies]

To: Fred Nerks; Tailback

https://en.wikipedia.org/wiki/Mohammad_Tawhidi

https://twitter.com/Imamofpeace

https://imamtawhidi.com/


33 posted on 01/28/2018 1:27:56 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 30 | View Replies]

http://www.abc.net.au/news/2017-06-23/imam-tawhidi-the-problem-with-the-medias-favourite-muslim/8643726


34 posted on 01/28/2018 1:43:04 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 33 | View Replies]

To: PGR88
20 millions Muslims have to be dealt with and governed - no one can just send them away.

Really?

Uncle Joe dealt with presumed hostile populations in exactly that way. He migrated them to less threatening locations.

https://en.wikipedia.org/wiki/Population_transfer_in_the_Soviet_Union

E.g., I happen to know a real estate agent who is a naturalized American from Russia. She speaks Russian, but looks completely (and beautifully) Korean. Because she is. Stalin deported her folks from the Soviet Far East to Kazakhstan, where her husband, a Korean-American Peace Corp volunteer found her. Stalin had worried that the Koreans in the Soviet Far East were loyal to the Japanese, an enemy of the Soviet Union. So, he moved them to Kazakhstan, isolated in the middle of Asia.

35 posted on 01/28/2018 2:12:22 AM PST by cynwoody
[ Post Reply | Private Reply | To 10 | View Replies]

To: Tailback

Wondered that myself as soon as I saw the headline.


36 posted on 01/28/2018 5:08:06 PM PST by little jeremiah (Half the truth is often a great lie. B. Franklin)
[ Post Reply | Private Reply | To 17 | View Replies]

To: NorseViking
Currently these schools are run by the invited Saudi clerics as they please.

I think until recently; probably not any more. Dozens of arrests and frozen/seized assets in early November.

37 posted on 01/28/2018 5:09:42 PM PST by little jeremiah (Half the truth is often a great lie. B. Franklin)
[ Post Reply | Private Reply | To 27 | View Replies]


Navigation: use the links below to view more comments.
first previous 1-2021-37 last

Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.

Free Republic
Browse · Search
News/Activism
Topics · Post Article

FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson