Free Republic
Browse · Search
News/Activism
Topics · Post Article

Skip to comments.

Gunman in Ukraine kills Putin foe in attack denounced as ‘state terrorism’
The Washington Compost ^ | March 23, 2017 | Andrew Roth and Natalie Gryvnak

Posted on 03/23/2017 11:15:36 AM PDT by Navy Patriot

click here to read article


Navigation: use the links below to view more comments.
first 1-2021 next last
How convenient.
1 posted on 03/23/2017 11:15:36 AM PDT by Navy Patriot
[ Post Reply | Private Reply | View Replies]

To: Navy Patriot

This will be blamed on Trump in 3, 2, 1. . .


2 posted on 03/23/2017 11:19:34 AM PDT by vladimir998 (Apparently I'm still living in your head rent free. At least now it isn't empty.)
[ Post Reply | Private Reply | To 1 | View Replies]

To: Navy Patriot

For the next 24-48 hours, the Enemy Media asks:

“What did Trump KNOW about this assassination and WHEN did he know it?!?!?!”


3 posted on 03/23/2017 11:21:26 AM PDT by Diana in Wisconsin (I don't have 'Hobbies.' I'm developing a robust Post-Apocalyptic skill set!)
[ Post Reply | Private Reply | To 1 | View Replies]

To: vladimir998
This will be blamed on Trump in 3, 2, 1. . .

Just for fun, read some of the comments in the Compost.

4 posted on 03/23/2017 11:25:44 AM PDT by Navy Patriot (America returns to the Rule of Law)
[ Post Reply | Private Reply | To 2 | View Replies]

To: Diana in Wisconsin
Well, it was in the Compost...
5 posted on 03/23/2017 11:27:31 AM PDT by Navy Patriot (America returns to the Rule of Law)
[ Post Reply | Private Reply | To 3 | View Replies]

To: Navy Patriot

My money is on the dead guy’s wife arranging this hit.

Cui bono...she’ll cry all the way to the bank.


6 posted on 03/23/2017 11:28:26 AM PDT by mac_truck (aide toi et dieu t'aidera)
[ Post Reply | Private Reply | To 1 | View Replies]

To: Navy Patriot

How convenient.


Yep. Those wily Ukrainians have a habit of offing Putin’s critics.


7 posted on 03/23/2017 11:28:31 AM PDT by lodi90
[ Post Reply | Private Reply | To 1 | View Replies]

To: Navy Patriot

“Just for fun, read some of the comments in the Compost.”

Ugh! Idiots are everywhere.


8 posted on 03/23/2017 11:41:34 AM PDT by vladimir998 (Apparently I'm still living in your head rent free. At least now it isn't empty.)
[ Post Reply | Private Reply | To 4 | View Replies]

To: lodi90

HAHA...

Russians kill thousands of Ukrainians....Russians on FR applaud it.


9 posted on 03/23/2017 11:57:55 AM PDT by KOZ.
[ Post Reply | Private Reply | To 7 | View Replies]

To: Navy Patriot
Freepers are everywhere... We walked by the corner less than 10 minutes after it happened. Police were just putting up the tape, people were all around, and traffic was backed up. Not knowing what had happened we high-tailed it out of there. If I hadn't decided to delay our metro ride by drinking a cup of coffee, we could have been there as it happened.
10 posted on 03/23/2017 12:23:39 PM PDT by The Truth Will Make You Free
[ Post Reply | Private Reply | To 1 | View Replies]

To: Navy Patriot
A suspected assailant was arrested after Voronenkov was shot twice in the head...

How convenient. The KGB wouldn't be that sloppy.

11 posted on 03/23/2017 12:57:38 PM PDT by McGruff (#PlugTheLeaks)
[ Post Reply | Private Reply | To 1 | View Replies]

To: Navy Patriot

I’d put my money on McShamey and his friends


12 posted on 03/23/2017 1:22:43 PM PDT by Nifster (I see puppy dogs in the clouds)
[ Post Reply | Private Reply | To 1 | View Replies]

To: Nifster
I’d put my money on McShamey and his friends

You hear me? No loose ends!

13 posted on 03/23/2017 2:38:14 PM PDT by Navy Patriot (America returns to the Rule of Law)
[ Post Reply | Private Reply | To 12 | View Replies]

To: Navy Patriot

Precisely


14 posted on 03/23/2017 2:48:39 PM PDT by Nifster (I see puppy dogs in the clouds)
[ Post Reply | Private Reply | To 13 | View Replies]

To: McGruff
A suspected assailant was arrested...

The getaway Uber was late.

15 posted on 03/23/2017 3:01:25 PM PDT by Navy Patriot (America returns to the Rule of Law)
[ Post Reply | Private Reply | To 11 | View Replies]

To: Navy Patriot

Two in the hat! Winter Hill Mob?


16 posted on 03/23/2017 9:50:12 PM PDT by namvolunteer (Obama says the US is subservient to the UN and the Constitution does not apply. That is treason.9we)
[ Post Reply | Private Reply | To 15 | View Replies]

To: McGruff; lodi90
The KGB wouldn't be that sloppy.

You are right, the Soviet KGB would not have been that sloppy. However, I am not sure that they would have killed a man like Denis Voronenkov, but now Putin has replaced KGB by other organs.

The killer is Pavlo Parshov, “an agent of Russian special services who infiltrated Ukrainian defense agencies.”

http://en.interfax.com.ua/news/general/412963.html

17 posted on 04/02/2017 1:20:15 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 11 | View Replies]

To: ETL
Russia is trying to cover up the case, by blaming it on organized crime https://en.crimerussia.com/gromkie-dela/new-version-of-voronenkov-murder-conflict-with-cashiers-gang/

Crime Russia is a Russian site for “active measures” https://www.theguardian.com/world/2016/may/07/discovered-our-parents-were-russian-spies-tim-alex-foley

18 posted on 04/02/2017 1:32:02 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 17 | View Replies]

To: AdmSmith

The Russian government is the number one organized crime unit in Russia.


19 posted on 04/03/2017 7:50:32 PM PDT by ETL (Trump admin apparently playing "good cop, bad cop" with thug Putin (see my FR Home page))
[ Post Reply | Private Reply | To 18 | View Replies]

To: ETL; The Westerner; lodi90; TigerLikesRooster

The 9 Russian Words That Explain KremlinGate
It’s International Talk Like a Chekist Day—here’s a quick primer on kombinatsiya, konspiratsiya and more
http://observer.com/2017/03/kremlingate-russia-spy-game-disinformation/


20 posted on 04/05/2017 7:04:57 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 19 | View Replies]


Navigation: use the links below to view more comments.
first 1-2021 next last

Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.

Free Republic
Browse · Search
News/Activism
Topics · Post Article

FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson