Free Republic
Browse · Search
News/Activism
Topics · Post Article

Skip to comments.

Iraq evacuation of Yazidis on hold as White House declares siege is over
The Guardian ^ | 08/14/2014 | Spencer Ackerman

Posted on 08/14/2014 5:57:50 AM PDT by SeekAndFind

The Obama administration has ruled out for now a risky US military mission to rescue thousands of Iraqis stranded on a northern Iraqi mountain, declaring a siege by Islamist extremists to be over.

After a small complement of special forces and US aid workers landed on Mount Sinjar to assess the situation of the Iraqi Yazidis – who for days have received air drops of food, water and medicine – the Pentagon said things were not as bad as initially feared. “An evacuation mission is far less likely,” said Rear Admiral John Kirby, the Pentagon press secretary, late on Wednesday.

US humanitarian aid drops would continue, Kirby said, but for now US planes or troops would not come to rescue the remaining Yazidis from the mountaintop terrain that has provided a harsh refuge.

The US has targeted Isis positions in the area with four air strikes since Saturday. The White House confidently declared the mission a success on Wednesday. “The president’s decisive decisions in the immediate wake of the crisis kept people alive and broke the siege of the mountain,” a White House official said.

(Excerpt) Read more at theguardian.com ...


TOPICS: Foreign Affairs; Front Page News; War on Terror
KEYWORDS: iraq; isis; kurdistan; seige; yazidi; yazidis
Navigation: use the links below to view more comments.
first previous 1-2021-38 last
To: null and void

Reminds one of the serbs, and how Clinton/nato came to rescue the poor abused moslems from Milosovic. But 4 airstrikes does not a war make.probably good mCcain is too fat to fit in a cockpit or he would probably help his isis buddies with some napalm on the mountain.


21 posted on 08/14/2014 7:04:18 AM PDT by Boowhoknew
[ Post Reply | Private Reply | To 2 | View Replies]

5% Carry 100% of Free Republic Expense


Click The Pic To Donate

Support FR Or Lose It

22 posted on 08/14/2014 7:04:37 AM PDT by DJ MacWoW (The Fed Gov is not one ring to rule them all)
[ Post Reply | Private Reply | To 1 | View Replies]

To: SeekAndFind
The president’s decisive decisions...

Pathetic.

23 posted on 08/14/2014 7:14:38 AM PDT by ecomcon
[ Post Reply | Private Reply | To 1 | View Replies]

To: Sweet Hour of Prayer

The parents are cutting themselves to give their children blood to drink. But, no worries...0bola says the siege is over ... as he continues his vacay.

How do you go from one day having Kerry/Hagel call this a humanitarian situation....to the next, with 0bola calling it “over”?


24 posted on 08/14/2014 7:15:33 AM PDT by Jane Long ("And when thou saidst, Seek ye my face; my heart said unto thee, Thy face, LORD, will I seek")
[ Post Reply | Private Reply | To 19 | View Replies]

To: null and void

First time I ever heard of the Yezidis was in the Gurdjieff’s “Meetings with Remarkable Men”

(From a J.G. Bennett website):

“The adolescent Gurdjieff saw a small boy weeping and struggling to escape, and being mocked by the other children:

I was puzzled and asked what it was all about. I learned that the boy in the middle was a Yezidi and the circle had been drawn round him and that he could not get out of it until it was rubbed away. The child was indeed trying with all his might to leave this magic circle, but he struggled in vain. I ran up to him and quickly rubbed out part of the circle, and immediately he dashed out and ran away as fast as he could

In 1888 the 16-year-old Gurdjieff witnessed a strange incident: he saw a little boy, weeping and making strange movements, struggling with all his might to break out of a circle drawn around him by other boys. Gurdjieff released the boy by erasing part of the circle and the child ran from his tormentors. The boy, Gurdjieff learned, was a Yezidi. He had heard only that Yezidis were “a sect living in Transcaucasia, mainly in the regions near Mount Ararat. They are sometimes called devil-worshippers.” Astonished by the incident, Gurdjieff made a point of telling us that he felt compelled to think seriously about the Yezidis. Inquiring of the adults he knew, he received contradictory opinions representative of the usual, prejudiced view of the Yezidis. But Gurdjieff remained unsatisfied.

A Complicated History

The story of the Yezidis can be traced back more than four thousand years—before they came to be called Yezidis—until the trail disappears into an unrecorded ‘prehistory.’ Based on few accounts, and those often contradictory, it is complex and difficult to follow.

Typical of the difficulties is a story told by the anthropologist Sami Said Ahmed, who completed a massive study of the Yezidis in 1975. He was given two manuscripts at different times, written by a Yezidi friend. Each purported to explain the beliefs of Yezidism with seemingly superficial legendary tales taken as fact, and each contradicted the other. Working assiduously, Ahmed eventually found that the manuscripts contained real facts and genuine articles of Yezidi belief, but in disguised form. When told of this, the Yezidi friend replied, “The book which I presented to you contains only one (fact) of the thousands (of facts) of Yezidism.” Further, he maintained that “Yezidism is the mother of all Eastern religions.”

Here we see some of the problems commonly encountered in attempting to understand the Yezidis. The first, and apparently the easiest to grasp, is their legendary secrecy—the keeping of their beliefs and practices hidden for fear of persecution for holding beliefs and practices that lie outside the sphere of orthodox approval. Again and again, they resisted conversion to Islam—or Christianity—except when they took on the outward forms for a period of time to avoid certain destruction.”

More here:

http://bennettpilgrimages.org/2014/08/07/gurdjieff-meetings-with-remarkable-men-bogachevsky-gurdjieff-introduces-the-yezidi/


25 posted on 08/14/2014 7:23:39 AM PDT by P.O.E. (Pray for America)
[ Post Reply | Private Reply | To 15 | View Replies]

To: SeekAndFind

islamist savage declares islamist savages non-threatening.


26 posted on 08/14/2014 7:32:14 AM PDT by onedoug
[ Post Reply | Private Reply | To 1 | View Replies]

To: P.O.E.

Thanks!


27 posted on 08/14/2014 7:34:10 AM PDT by null and void (If Bill Clinton was the first black president, why isn't Barack Obama the first woman president?)
[ Post Reply | Private Reply | To 25 | View Replies]

To: Sweet Hour of Prayer
Remind me why we bombed Yugoslavia and assisted with the creation of Kosovo.

Because "ethnic cleansing" is only to be resisted when the Muslims are on the losing end.

28 posted on 08/14/2014 7:43:52 AM PDT by Charles Martel (Endeavor to persevere...)
[ Post Reply | Private Reply | To 19 | View Replies]

To: I want the USA back; All
obozo is a traitor, muzzie collaborator..he will not hurt his own, as he's working with them against the people of the US. So Christians, Jews will die because of this traitor in our White House..more blood on obozo’s hands. Notice that obozo ALWAYS supports the “wrong side” all by design. How can his military advisers stand & bow to this traitor? They know who and what he is, yet they continue to work with him on “policy.” And people we Americans would help, who are begging for arms to fight ISIS, will die because obozo refuses to help them, rescue them. All he will do is drop them food & water, but no real weapons, instead of the real means to save themselves. obozo makes his decisions & vacations..while people are dying because of of his decisions.

Where are the Praetorian Guards in Washington, in the White House...real soliders who love this country and will stand up & fight, rather than just saving their azz & careers by cooperating with a traitor, a killer, in our White House?

29 posted on 08/14/2014 8:04:45 AM PDT by itssme
[ Post Reply | Private Reply | To 4 | View Replies]

To: null and void

You’re welcome :>


30 posted on 08/14/2014 9:04:55 AM PDT by P.O.E. (Pray for America)
[ Post Reply | Private Reply | To 27 | View Replies]

To: null and void

The Yazidis sure are a strange bunch when it comes to their religious beliefs. Seems like they collected a little from just about every religion prior to Christianity, including paganism to get the devil worship. But, it seems like they haven’t turned bloodthirsty and truly evil in their actions as the muslims have. ISIS wants to kill anyone and everyone who will not convert to their ways, hence the evil persecution of the Yazidis.
As a side note…I wish the news “readers” would quit lumping the Iraqi Christians and the Yazidis in their reporting, makes them sound like the Yazidis are Iraqi Christians. Never the less, the true evil here is ISIS, IMO, they are the embodiment of the devil on earth.


31 posted on 08/14/2014 9:44:30 AM PDT by Oorang (Tyranny thrives where government need not fear the wrath of an armed people - Alex Kozinski)
[ Post Reply | Private Reply | To 15 | View Replies]

To: SeekAndFind
0bama’s America: Harmless as an enemy, treacherous as a friend.
32 posted on 08/14/2014 11:34:45 AM PDT by mojito (Zero, our Nero.)
[ Post Reply | Private Reply | To 1 | View Replies]

To: dennisw; Cachelot; Nix 2; veronica; Catspaw; knighthawk; Alouette; Optimist; weikel; Lent; GregB; ..
Middle East and terrorism, occasional political and Jewish issues Ping List. High Volume If you’d like to be on or off, please FR mail me.

..................

If he says it's over, it's over

33 posted on 08/14/2014 11:36:04 AM PDT by SJackson (incompetent and feckless..the story of the Obama presidency. No hand on the f***ing tiller, Hillary)
[ Post Reply | Private Reply | To 1 | View Replies]

To: null and void
Whoa.....The Yazidis are an ancient religion, one whose people revere Melek Taus, who is also known as the Peacock Angel, or Shaytan, or in English: Satan. ....Amazing. Amazing that the leadership in this country has sunken so low, and so unashamedly.
34 posted on 08/14/2014 12:22:37 PM PDT by SisterK
[ Post Reply | Private Reply | To 15 | View Replies]

To: Free America52
"Are they that stupid ... or do they think we are that stupid?"

BOTH!
35 posted on 08/14/2014 1:25:08 PM PDT by rhubarbk (It's official, I'm suffering from Obama fatigue!)
[ Post Reply | Private Reply | To 18 | View Replies]

To: SeekAndFind

The Obama administration assesses that there are not enough left to be worth saving.

...and there never will be.


36 posted on 08/14/2014 2:39:16 PM PDT by BeauBo
[ Post Reply | Private Reply | To 1 | View Replies]

To: SeekAndFind

I don’t believe a word Obama or anyone else in the government says. So they send in a few soldiers and report that all is good. How convenient.

What really pisses me off is there’s not one person in the know about Obama that is willing to fall on his sword for America.


37 posted on 08/14/2014 6:07:59 PM PDT by VerySadAmerican (Liberals were raised by women or wimps. And they're all stupid.)
[ Post Reply | Private Reply | To 1 | View Replies]

To: SeekAndFind; null and void; Dajjal
Part of the answer is that the West is in the grip of theological illiteracy. It has stubbornly refused to grasp the implications of a global Islamic revival which has been gaining steam for the best part of a century. The Islamic Movement looks back to the glory days of conquest as Islam's finest hour, and seeks to revive Islamic supremacy through jihad and sacrifice. It longs for a truly Islamic state – the caliphate reborn – and considers jihad to be the God-given means to usher it in.

This worldview was promoted in compelling, visionary terms by Indian scholar Abul A’la Maududi, whose writings continue to be widely disseminated by Islamic bookshops and mosques across the West. Maududi argued in his radicalisation primer Let us be Muslims that the only valid form of government is Islamic theocracy – i.e. sharia rule – and Muslims are duty-bound to use whatever power they can muster to impose this goal on the world: ‘whoever you are, in whichever country you live, you must strive to change the wrong basis of government, and seize all powers to rule and make laws from those who do not fear God. … The name of this striving is jihad.’ And ‘If you believe Islam to be true, you have no alternative but to exert your utmost strength to make it prevail on earth: you either establish it or give your lives in this struggle.’

The treatment of captives by IS is also in accordance with orthodox rules of war in Islam, which permit men to be killed, while women and children are enslaved. Sex slavery – concubinage – is permitted by the sharia principles which guide IS. The Reliance of the Traveller – a respected Sunni manual of sharia law – states: ‘When a child or a woman is taken captive, they become slaves by the fact of capture, and the woman's previous marriage is immediately annulled’ (chapter o9.13). The option of converting to Islam to avoid death or capture – which is being urged upon non-Muslims by IS – is also clearly supported: ‘Whoever enters Islam before being captured may not be killed or his property confiscated, or his young children taken captive’ (chapter o9.12).

The widespread looting of property is also validated by Islam's rules of war: ‘A free male Muslim who has reached puberty and is sane is entitled to the spoils of battle when he has participated in a battle to the end of it’ (chapter o10.1). And ‘Anyone who … kills one of the enemy or effectively incapacitates him, risking his own life thereby, is entitled to whatever he can take from the enemy, meaning as much as he can take away with him in the battle, such as a mount, clothes, weaponry, money or other’ (chapter o10.2).

The grim reality is that the fate of Christians and Yazidis in northern Iraq today all too often matches the stipulations of Islamic textbooks: non-Muslim men are killed, their women and children enslaved, and their property and possessions looted.

http://www.meforum.org/4774/islam-genocide-middle-east

38 posted on 08/15/2014 2:23:02 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 1 | View Replies]


Navigation: use the links below to view more comments.
first previous 1-2021-38 last

Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.

Free Republic
Browse · Search
News/Activism
Topics · Post Article

FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson