Free Republic
Browse · Search
News/Activism
Topics · Post Article


1 posted on 07/21/2014 1:16:53 PM PDT by Tailgunner Joe
[ Post Reply | Private Reply | View Replies ]


Navigation: use the links below to view more comments.
first 1-2021-30 next last
To: Tailgunner Joe

Isn’t it great that Hillary gave the Russians the Reset Button?


2 posted on 07/21/2014 1:18:48 PM PDT by Pearls Before Swine
[ Post Reply | Private Reply | To 1 | View Replies ]

To: Tailgunner Joe

Riiiiight. And the moon landing was faked and I kidnapped the Lindbergh baby.


3 posted on 07/21/2014 1:18:55 PM PDT by RIghtwardHo
[ Post Reply | Private Reply | To 1 | View Replies ]

To: Tailgunner Joe
A country run by a KGB colonel.

Could they be projecting?

4 posted on 07/21/2014 1:21:07 PM PDT by wideawake
[ Post Reply | Private Reply | To 1 | View Replies ]

To: Tailgunner Joe

Probably the same CIA guys who invented crack cocaine in order to enslave American blacks and “keep ‘em down”.


5 posted on 07/21/2014 1:22:06 PM PDT by Sans-Culotte (Psalm 14:1 ~ The fool says in his heart, “There is no God.”)
[ Post Reply | Private Reply | To 1 | View Replies ]

To: Tailgunner Joe

Let’s seee.... the CIA sneaked a missile battery (capable of tracking and hitting an aircraft at 33,000 ft.) into a hostile battlefield, did the deed, and then sneaked out without anybody noticing.

Okay.


6 posted on 07/21/2014 1:22:46 PM PDT by alancarp
[ Post Reply | Private Reply | To 1 | View Replies ]

To: Tailgunner Joe

I’m not familiar with Channel One. Is it state-owned, or nominally state-owned?


7 posted on 07/21/2014 1:23:08 PM PDT by 1rudeboy
[ Post Reply | Private Reply | To 1 | View Replies ]

To: Tailgunner Joe

Actually, I saw a video last week that predicted something big after the BRICS summit. I think that we’ve learned over the past decade that the tinfoil hat brigade has been on to something for a long time.


9 posted on 07/21/2014 1:27:16 PM PDT by Bryanw92 (Sic semper tyranni)
[ Post Reply | Private Reply | To 1 | View Replies ]

To: Tailgunner Joe

The CIA is not that smart, but, the One, able to garner a peace prize for nothing, would be diabolical enough to think he can out Putin Putin.


10 posted on 07/21/2014 1:30:45 PM PDT by depressed in 06 (America conceived in liberty, dies in slavery.)
[ Post Reply | Private Reply | To 1 | View Replies ]

Propaganda unearthed by NBC news... The irony!


11 posted on 07/21/2014 1:33:46 PM PDT by Gene Eric (Don't be a statist!)
[ Post Reply | Private Reply | To 1 | View Replies ]

To: Tailgunner Joe

Well... These guys (The CIA) have been the gang who couldn’t shoot straight for years.

If they pulled this off, I would be shocked. And what is the upside for the CIA?

My money is still on a drunken Russian. Not sure what side he was nominally on.


12 posted on 07/21/2014 1:34:10 PM PDT by redgolum ("God is dead" -- Nietzsche. "Nietzsche is dead" -- God.)
[ Post Reply | Private Reply | To 1 | View Replies ]

To: Tailgunner Joe

It must be great when a compliant media acts as a propaganda outlet for a supreme dictator. Just ask Obama.


13 posted on 07/21/2014 1:34:48 PM PDT by Dalberg-Acton
[ Post Reply | Private Reply | To 1 | View Replies ]

To: Tailgunner Joe

Well, John McCain got one thing right. He saw KGB when he looked into Putin’s eyes.

Broken clock ...


14 posted on 07/21/2014 1:38:58 PM PDT by BuckeyeTexan (There are those that break and bend. I'm the other kind. ~Steve Earle)
[ Post Reply | Private Reply | To 1 | View Replies ]

To: Tailgunner Joe

What about the Jews? I’m surprised someone hasn’t blamed them by now.


15 posted on 07/21/2014 1:38:59 PM PDT by Opinionated Blowhard ("When the people find they can vote themselves money, that will herald the end of the republic.")
[ Post Reply | Private Reply | To 1 | View Replies ]

To: Tailgunner Joe

It appears the Russian public are more gullible and credulous than even Obama voters.


16 posted on 07/21/2014 1:43:30 PM PDT by PGR88
[ Post Reply | Private Reply | To 1 | View Replies ]

To: Tailgunner Joe

What’s sad is that many of the Russian people will believe it. In Russia, America is the tyrant of the Earth. What’s sad is that Obama and co are too lazy and/or incompetent to address this propaganda.


18 posted on 07/21/2014 1:47:12 PM PDT by Morpheus2009
[ Post Reply | Private Reply | To 1 | View Replies ]

To: Tailgunner Joe

People have to understand that Russian TV pretty much means government. The top 3 networks in Russia are (2) government owned outright and (1) owned by Gazprom which is government owned (actual majority)

Russian TV is pretty much the voice of the Kremlin


20 posted on 07/21/2014 1:49:48 PM PDT by GeronL (Vote for Conservatives not for Republicans)
[ Post Reply | Private Reply | To 1 | View Replies ]

To: Tailgunner Joe

LOL

Maybe the writer of this fiction will earn a Politburo award..


23 posted on 07/21/2014 2:05:17 PM PDT by Vendome (Don't take life so seriously-you won't live through it anyway-Enjoy Yourself ala Louis Prima)
[ Post Reply | Private Reply | To 1 | View Replies ]

To: Tailgunner Joe

Great, now the CIA e-mails will go missing. Oh wait, they
don’t have e-mail.

I think George Bush and Lindsey Lohan did it but
nobody will listen.

Or

Putin, you just shot down a civilian airliner and the
United States “Fagboy in Chief” is not happy, happy happy.

What you gonna do now?


24 posted on 07/21/2014 2:13:32 PM PDT by eyedigress ((zOld storm chaser from the west)/?s)
[ Post Reply | Private Reply | To 1 | View Replies ]

To: Tailgunner Joe; gandalftb; ASA Vet; nuconvert

Some technical background about the BUK-M system that was used against MH17:

http://corporalfrisk.wordpress.com/2014/07/19/the-buk-and-mh17/


28 posted on 07/21/2014 2:22:12 PM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 1 | View Replies ]

To: Tailgunner Joe

We’ll never know...


38 posted on 07/21/2014 3:39:37 PM PDT by Iscool
[ Post Reply | Private Reply | To 1 | View Replies ]


Navigation: use the links below to view more comments.
first 1-2021-30 next last

Free Republic
Browse · Search
News/Activism
Topics · Post Article


FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson