Free Republic
Browse · Search
News/Activism
Topics · Post Article

Skip to comments.

Turkey concludes Saudi journalist Jamal Khashoggi killed by 'murder' team, sources say
Washington Compost ^ | October 6 at 7:02 PM | Kareem Fahim

Posted on 10/06/2018 9:38:07 PM PDT by robowombat

ISTANBUL — Turkey has concluded that Jamal Khashoggi, a prominent journalist from Saudi Arabia, was killed in the Saudi Consulate in Istanbul earlier this week by a Saudi team sent “specifically for the murder,” two people with knowledge of the probe said Saturday.

Turkish investigators believe a 15-member team “came from Saudi Arabia. It was a preplanned murder,” said one of the people. Both spoke on the condition of anonymity to discuss the ongoing investigation.

They offered no specific evidence to back up the account. Earlier Saturday, however, Turkey’s Anadolu news agency said the Istanbul public prosecutor’s office had opened a probe into Khashoggi’s disappearance. Turkish authorities have said that Khashoggi never left the consulate

(Excerpt) Read more at washingtonpost.com ...


TOPICS: Crime/Corruption; Culture/Society; Foreign Affairs; War on Terror
KEYWORDS: districtofcolumbia; erdogan; istanbul; jamalkhashoggi; kareemfahim; khashoggi; kurdistan; receptayyiperdogan; saudi; saudiarabia; sethrich; turkey; washingtoncompost; washingtonpost
Navigation: use the links below to view more comments.
first previous 1-2021-4041-6061-80 ... 141-142 next last
To: robowombat

I have no idea of her worth, but she lives in a 60 year old house and shows no indication of great wealth.


21 posted on 10/07/2018 1:27:27 PM PDT by editor-surveyor (Freepers: Not as smart as I'd hoped they'd be)
[ Post Reply | Private Reply | To 3 | View Replies]

To: robowombat; editor-surveyor; Innovative; drop 50 and fire for effect; Pontiac; SunkenCiv; ...
“Everything was videotaped to prove the mission had been accomplished and the tape was taken out of the country,”

https://www.middleeasteye.net/news/turkey-has-concrete-information-saudi-journalists-fate-says-erdogan-adviser-131833323

Comment: Did the Saudis sent the video by email?

Yasin Aktay: Before entering the Saudi consulate, Khashoggi told his fiancé Miss Hatice to call myself and Turan Kislakci if something happened to him.

By the way, it seems that at the beginning, Khashoggi’s abduction or murder was presented as a success of the intelligence service in the Saudi media. Of course, there was a great confusion there too. When it was found out that he was missing, the news were reporting that he was arrested by Interpol.

First of all, there was no search warrant for him, and secondly, there was nothing successful about this whether it be intelligence-wise or operational.

https://www.yenisafak.com/en/columns/yasinaktay/what-was-jamal-khashoggis-blunder-2046673

The Ministry of Foreign Affairs on Sunday summoned Saudi Arabian Ambassador Waleed A. M. Elkhereiji for the second time after journalist Jamal Khashoggi’s disappearance and demanded permission to search the consulate building in Istanbul, diplomatic sources said Monday.
https://www.dailysabah.com/diplomacy/2018/10/08/turkey-demands-permission-to-search-saudi-consulate-after-journalist-khashoggis-disappearance

22 posted on 10/08/2018 4:19:11 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 1 | View Replies]

To: AdmSmith
Turkish: Cemal Kaşıkçı Arabic: جمال خاشقجي
23 posted on 10/08/2018 4:52:27 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 22 | View Replies]

To: AdmSmith

If the Turks have the video, it is likely that the room that was used is known. It is difficult to get rid of all DNA.


24 posted on 10/08/2018 5:00:22 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 23 | View Replies]

To: AdmSmith

Saudi denials – and deflection – of any knowledge of Khashoggi’s whereabouts read from a Kremlin playbook, as does his alleged death.

Turkey, meanwhile – the world’s most prolific jailer of journalists – now finds itself in the peculiar position of being a champion for a columnist who vanished under its nose.
https://www.theguardian.com/world/2018/oct/07/khashoggi-case-against-saudi-agents-reverberates-through-ankara-and-riyadh


25 posted on 10/08/2018 5:16:45 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 24 | View Replies]

To: AdmSmith
There's no way the Turks have any idea about the existence of any videotape, and the idea that the Erdogan regime would concern itself about a foreign or a Turkish journalist is ludicrous.

26 posted on 10/08/2018 9:05:36 AM PDT by SunkenCiv (and btw -- https://www.gofundme.com/for-rotator-cuff-repair-surgery)
[ Post Reply | Private Reply | To 22 | View Replies]

To: robowombat

Saudis are going to allow Turk police to go into Consul.

Yes, Adnan Kashoggi was a cousin of this man.


27 posted on 10/08/2018 2:05:24 PM PDT by BeadCounter
[ Post Reply | Private Reply | To 1 | View Replies]

To: SunkenCiv
the idea that the Erdogan regime would concern itself about a foreign or a Turkish journalist is ludicrous.

Erdogan would take it as an affront that the Saudis would do this so openly on Turkish soil.

The man has an overblown ego and he no doubt feels insulted.

28 posted on 10/08/2018 2:58:15 PM PDT by Pontiac (The welfare state must fail because it is contrary to human nature and diminishes the human spirit.)
[ Post Reply | Private Reply | To 26 | View Replies]

To: Pontiac
He's grinding some kind of axe, what that is exactly will emerge, probably soon.

29 posted on 10/08/2018 3:04:20 PM PDT by SunkenCiv (and btw -- https://www.gofundme.com/for-rotator-cuff-repair-surgery)
[ Post Reply | Private Reply | To 28 | View Replies]

To: SunkenCiv

He has made it obvious that he intends to be the dominant force in the Islamic World. How this fits in to that plan; who knows?


30 posted on 10/08/2018 4:21:52 PM PDT by Pontiac (The welfare state must fail because it is contrary to human nature and diminishes the human spirit.)
[ Post Reply | Private Reply | To 29 | View Replies]

To: Pontiac
He's living in a dream world. He's not even the most dominant Islamic force in the Middle East.

31 posted on 10/08/2018 5:20:29 PM PDT by SunkenCiv (and btw -- https://www.gofundme.com/for-rotator-cuff-repair-surgery)
[ Post Reply | Private Reply | To 30 | View Replies]

To: SunkenCiv

True

But in matters of international power plays is occasionally comes down to the bold and the dead.

Will he be bold enough to take the prize?


32 posted on 10/08/2018 8:17:24 PM PDT by Pontiac (The welfare state must fail because it is contrary to human nature and diminishes the human spirit.)
[ Post Reply | Private Reply | To 31 | View Replies]

To: Pontiac

Whatever happens, when Erdogan goes, whatever follows will be worse, and not by a little bit. That fact acts like a bulletproof vest for him, and he needs one, because otherwise he’d have been assassinated by now.


33 posted on 10/08/2018 9:45:27 PM PDT by SunkenCiv (and btw -- https://www.gofundme.com/for-rotator-cuff-repair-surgery)
[ Post Reply | Private Reply | To 32 | View Replies]

To: SunkenCiv
I agree

Erdogan’s succession path is a bloody one.

But that is the norm for Islamic countries.

He chose to take Turkey down that path. He has no right to expect anything different. His actions say that he realizes the fact. His level of paranoia has risen steadily in my observation.

34 posted on 10/08/2018 10:44:45 PM PDT by Pontiac (The welfare state must fail because it is contrary to human nature and diminishes the human spirit.)
[ Post Reply | Private Reply | To 33 | View Replies]

To: Innovative

LOLOL


35 posted on 10/08/2018 10:46:30 PM PDT by caww
[ Post Reply | Private Reply | To 7 | View Replies]

To: Pontiac
Everyone dies. My point is, even Erdogan is better for us than whatever will follow. Whatever is going on will wind up looking like the good old days once he's gone.

36 posted on 10/08/2018 11:21:53 PM PDT by SunkenCiv (and btw -- https://www.gofundme.com/for-rotator-cuff-repair-surgery)
[ Post Reply | Private Reply | To 34 | View Replies]

To: SunkenCiv

Given the rising tide of Orthodox Islam in Turkey I agree that it highly likely that barring outside influence (invasion maybe) Erdogon will be followed by a more Orthodox Muslim than he.


37 posted on 10/09/2018 12:20:28 AM PDT by Pontiac (The welfare state must fail because it is contrary to human nature and diminishes the human spirit.)
[ Post Reply | Private Reply | To 36 | View Replies]

To: Pontiac
He's shown an aptitude for ruling by fear; that doesn't bode well for either a return to a democratic, pluralistic society with unique safeguards against the rise of Islamofascist regimes, or to the rise of something more like the mullahcracy in Iran. I'd love to be wrong and see him succeeded by secular-minded (which he is at base, but he uses Islam as a political crutch) freely elected officials. Problem is, he's ruling based on a clear majority of the country, a populist if you will. And Turkey serves as the cork in the bottle, a barrier between the real Islamic nutjobs of the Middle East, and Europe.

38 posted on 10/09/2018 1:09:13 AM PDT by SunkenCiv (and btw -- https://www.gofundme.com/for-rotator-cuff-repair-surgery)
[ Post Reply | Private Reply | To 37 | View Replies]

To: SunkenCiv
I'd love to be wrong and see him succeeded by secular-minded (which he is at base, but he uses Islam as a political crutch) freely elected officials.

The only path to that I see possible is a Military coup d'é·tat.

Something along the lines of Francisco Franco I would view favorably.

Not ideal, but given the population of the country perhaps the best that can be hoped for.

39 posted on 10/09/2018 1:39:22 AM PDT by Pontiac (The welfare state must fail because it is contrary to human nature and diminishes the human spirit.)
[ Post Reply | Private Reply | To 38 | View Replies]

To: robowombat; Pelham

This is a fascinating situation

No question he got the Tony Spilotro slash (get it) Roy DeMeo tupperware party in that consulate in Istanbul

Or he’s held somewhere

Not likely cause the Turks are all over this

I wondered if he was related to former super rich Adnan Kashoggi.....80s big wig

This Kashoggi was an anti Trump Saudi in contrast to the new de facto shotcaller Mohammed bin Salman

Kashoggi was also a pal to Bin Laden and think Crown Prince Salman is too soft on Israel and doesn’t support Saudi war on Iran nor Salman attempts to westernize

This new boss man is very shrewd and ruthless in a tough room

He’s already busted up his oligarch cousins who challenged him and took just enough of their money to leave them still rich but far less powerful

And now he’s shown he’s willing to kill opponents even abroad

It’s fascinating

A new worm has turned there


40 posted on 10/09/2018 1:54:46 AM PDT by wardaddy (I donÂ’t care that youÂ’re not a racist......when the shooting starts it wonÂ’t matte)
[ Post Reply | Private Reply | To 1 | View Replies]


Navigation: use the links below to view more comments.
first previous 1-2021-4041-6061-80 ... 141-142 next last

Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.

Free Republic
Browse · Search
News/Activism
Topics · Post Article

FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson