Free Republic
Browse · Search
News/Activism
Topics · Post Article

Skip to comments.

China Is Vacuuming Up DNA Samples From Xinjiang's Muslims
buzzfeed ^ | Megha Rajagopalan

Posted on 12/13/2017 12:55:19 PM PST by BenLurkin

click here to read article


Navigation: use the links below to view more comments.
first 1-2021-23 next last
The Democrat Party would love to do that here.
1 posted on 12/13/2017 12:55:20 PM PST by BenLurkin
[ Post Reply | Private Reply | View Replies]

To: BenLurkin

Talk about meta-data....

“....We picked up some DNA from that explosion last weekend, and it seems there’s a 95% chance that person was your first-cousin, or closer. Anything you want to tell us, Achmed?”


2 posted on 12/13/2017 12:58:20 PM PST by PGR88
[ Post Reply | Private Reply | To 1 | View Replies]

Thanks so much for your support to this point... I personally apprecaite it...
FReepers, it's far beyond time to wrap up this FReep-a-thon.  Lets do it today.  Please chip in.


President Donald J. Trump and the Free Republic of the United States of America
President Donald J. Trump's address to the United Nations on 09/19/2017.

Ramirez political cartoon:  the Roy Moore Compass LARGE VERSION 12/11/2017: LINK  LINK to regular sized versions of his political cartoons (archive).
Garrison political cartoon:  Moore or Less LARGE VERSION 12/11/2017: LINK  LINK (scroll down) to regular sized versions of his political cartoons (archive).

Please join the monthlies, an automated and the best way to help support Free Republic.  If you opt not to join the automated monthly support program, please consider joining the One One Done project.  LINK

Click above and pencil in your donation now.
Please folks, lets end this FReepathon.  Thank you!

...this is a general all-purpose message, and should not be seen as targeting any individual I am responding to...

3 posted on 12/13/2017 1:01:24 PM PST by DoughtyOne (This forum is a Doug Jones free zone! Go Roy Moore!)
[ Post Reply | Private Reply | To 1 | View Replies]

To: BenLurkin

China is a very Progressive country!


4 posted on 12/13/2017 1:01:52 PM PST by TigersEye (0bama. The Legacy is a lie. The lie is the Legacy.)
[ Post Reply | Private Reply | To 1 | View Replies]

To: BenLurkin

Will they tell them their ancestors were Pigs ?


5 posted on 12/13/2017 1:02:09 PM PST by butlerweave
[ Post Reply | Private Reply | To 1 | View Replies]

To: BenLurkin

Smart move by the commies.


6 posted on 12/13/2017 1:02:56 PM PST by ZULU (DITCH MITCH!!! DUMP RYAN!! DROP DEAD MCCAIN!! KIM FATTY the THIRD = Kim Jung Un)
[ Post Reply | Private Reply | To 1 | View Replies]

To: BenLurkin

China doesn’t trust the Muzzies EITHER!


7 posted on 12/13/2017 1:06:02 PM PST by 2harddrive
[ Post Reply | Private Reply | To 1 | View Replies]

To: BenLurkin

Of late it seems Russia has been replaced with China, in that I’m reading a lot of negative things out of China all of a sudden. For literally decades we read nothing but glowing party line trash out of China, like it had been dictated by a top member of their politburo.

China does REQUIRE close scrutiny, so don’t take this the wrong way, but we need to keep things in perspective too.

Demonizing any nation is not helpful to us. An open discussion generally is. It just seems all of a sudden China has become the new Great Satan, the follow on to Russia and Putin.

One might almost think the war guys like McCain and company have been pushing for, has been relocated.


8 posted on 12/13/2017 1:08:09 PM PST by DoughtyOne (This forum is a Doug Jones free zone! Go Roy Moore!)
[ Post Reply | Private Reply | To 1 | View Replies]

To: BenLurkin

There a re more than a few Uighur fighting in Syria, so many so that China has sent some of its elite forces to deal with them in Syria.


9 posted on 12/13/2017 1:08:45 PM PST by PIF (They came for me and mine ... now it is your turn ...)
[ Post Reply | Private Reply | To 1 | View Replies]

To: BenLurkin

They don’t have too.

Stupid Americans are enthusiastically shipping their DNA off to Ancestry dot com.


10 posted on 12/13/2017 1:13:30 PM PST by Eddie01
[ Post Reply | Private Reply | To 1 | View Replies]

To: BenLurkin

Violate the rights of ethnic minorities

in the Muslim-majority Xinjiang


11 posted on 12/13/2017 1:25:43 PM PST by Cold Heart
[ Post Reply | Private Reply | To 1 | View Replies]

To: Eddie01

I’ve wondered about that myself. I’d like to know what percentage I am of American Indian, but not bad enough to the swampsters know it too.


12 posted on 12/13/2017 1:52:20 PM PST by redfreedom
[ Post Reply | Private Reply | To 10 | View Replies]

To: Cold Heart

I seriously doubt if they have any rights in commie China. For sure they do not have the same rights we do in our country.


13 posted on 12/13/2017 1:53:40 PM PST by redfreedom
[ Post Reply | Private Reply | To 11 | View Replies]

To: BenLurkin

We’ll be looking at camels in a new light once this project is complete.


14 posted on 12/13/2017 1:57:59 PM PST by moovova
[ Post Reply | Private Reply | To 1 | View Replies]

To: BenLurkin

A very thin line divides China from North Korea.

And they are closing the gap every day.


15 posted on 12/13/2017 1:58:57 PM PST by Celerity
[ Post Reply | Private Reply | To 1 | View Replies]

To: redfreedom

Just pointing out the irony of the two statements from the article


16 posted on 12/13/2017 2:09:44 PM PST by Cold Heart
[ Post Reply | Private Reply | To 13 | View Replies]

To: BenLurkin

They don’t seem to mess around when it comes to protecting their western border.


17 posted on 12/13/2017 2:10:15 PM PST by gunsequalfreedom
[ Post Reply | Private Reply | To 1 | View Replies]

To: redfreedom
I’ve wondered about that myself. I’d like to know what percentage I am of American Indian...

You don't need a test for that. As long as you have high cheek bones and your parents talked about Indians when you were a kid - poof - you too can be like Elizabeth Warren, blue eyes and all.

18 posted on 12/13/2017 2:12:01 PM PST by gunsequalfreedom
[ Post Reply | Private Reply | To 12 | View Replies]

To: AdmSmith; AnonymousConservative; Berosus; Bockscar; cardinal4; ColdOne; Convert from ECUSA; ...
Thanks BenLurkin. So, when they identify the suspect this way, they have to shout "Eureka!"

19 posted on 12/13/2017 4:26:16 PM PST by SunkenCiv (www.tapatalk.com/groups/godsgravesglyphs/, forum.darwincentral.org, www.gopbriefingroom.com)
[ Post Reply | Private Reply | View Replies]

To: BenLurkin; TigerLikesRooster; SunkenCiv
In Your Face: China’s all-seeing state

China has been building what it calls “the world's biggest camera surveillance network”. Across the country, 170 million CCTV cameras are already in place and an estimated 400 million new ones will be installed in the next three years.
Many of the cameras are fitted with artificial intelligence, including facial recognition technology. The BBC’s John Sudworth has been given rare access to one of the new hi-tech police control rooms.
http://www.bbc.com/news/av/world-asia-china-42248056/in-your-face-china-s-all-seeing-state


Watch the 5 min video.

20 posted on 12/14/2017 1:15:43 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 1 | View Replies]


Navigation: use the links below to view more comments.
first 1-2021-23 next last

Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.

Free Republic
Browse · Search
News/Activism
Topics · Post Article

FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson