The Democrat Party would love to do that here.
1 posted on
12/13/2017 12:55:20 PM PST by
BenLurkin
To: BenLurkin
Talk about meta-data....
“....We picked up some DNA from that explosion last weekend, and it seems there’s a 95% chance that person was your first-cousin, or closer. Anything you want to tell us, Achmed?”
2 posted on
12/13/2017 12:58:20 PM PST by
PGR88
Thanks so much for your support to this point... I personally apprecaite it...
FReepers, it's far beyond time to wrap up this FReep-a-thon. Lets do it today. Please chip in.
President Donald J. Trump and the Free Republic of the United States of America
President Donald J. Trump's address to the United Nations on 09/19/2017.
Ramirez political cartoon: the Roy Moore Compass LARGE VERSION 12/11/2017: LINK LINK to regular sized versions of his political cartoons (archive).
Garrison political cartoon: Moore or Less LARGE VERSION 12/11/2017: LINK LINK (scroll down) to regular sized versions of his political cartoons (archive).
Please join the monthlies, an automated and the best way to help support Free Republic. If you opt not to join the automated monthly support program, please consider joining the One One Done project. LINK
Click above and pencil in your donation now.Please folks, lets end this FReepathon. Thank you!...this is a general all-purpose message, and should not be seen as targeting any individual I am responding to...
3 posted on
12/13/2017 1:01:24 PM PST by
DoughtyOne
(This forum is a Doug Jones free zone! Go Roy Moore!)
To: BenLurkin
China is a very Progressive country!
4 posted on
12/13/2017 1:01:52 PM PST by
TigersEye
(0bama. The Legacy is a lie. The lie is the Legacy.)
To: BenLurkin
Will they tell them their ancestors were Pigs ?
To: BenLurkin
Smart move by the commies.
6 posted on
12/13/2017 1:02:56 PM PST by
ZULU
(DITCH MITCH!!! DUMP RYAN!! DROP DEAD MCCAIN!! KIM FATTY the THIRD = Kim Jung Un)
To: BenLurkin
China doesn’t trust the Muzzies EITHER!
To: BenLurkin
Of late it seems Russia has been replaced with China, in that I’m reading a lot of negative things out of China all of a sudden. For literally decades we read nothing but glowing party line trash out of China, like it had been dictated by a top member of their politburo.
China does REQUIRE close scrutiny, so don’t take this the wrong way, but we need to keep things in perspective too.
Demonizing any nation is not helpful to us. An open discussion generally is. It just seems all of a sudden China has become the new Great Satan, the follow on to Russia and Putin.
One might almost think the war guys like McCain and company have been pushing for, has been relocated.
8 posted on
12/13/2017 1:08:09 PM PST by
DoughtyOne
(This forum is a Doug Jones free zone! Go Roy Moore!)
To: BenLurkin
There a re more than a few Uighur fighting in Syria, so many so that China has sent some of its elite forces to deal with them in Syria.
9 posted on
12/13/2017 1:08:45 PM PST by
PIF
(They came for me and mine ... now it is your turn ...)
To: BenLurkin
They don’t have too.
Stupid Americans are enthusiastically shipping their DNA off to Ancestry dot com.
10 posted on
12/13/2017 1:13:30 PM PST by
Eddie01
To: BenLurkin
Violate the rights of ethnic minorities
in the Muslim-majority Xinjiang
To: BenLurkin
We’ll be looking at camels in a new light once this project is complete.
14 posted on
12/13/2017 1:57:59 PM PST by
moovova
To: BenLurkin
A very thin line divides China from North Korea.
And they are closing the gap every day.
15 posted on
12/13/2017 1:58:57 PM PST by
Celerity
To: BenLurkin
They don’t seem to mess around when it comes to protecting their western border.
To: BenLurkin; TigerLikesRooster; SunkenCiv
In Your Face: Chinas all-seeing state
China has been building what it calls “the world's biggest camera surveillance network”. Across the country, 170 million CCTV cameras are already in place and an estimated 400 million new ones will be installed in the next three years.
Many of the cameras are fitted with artificial intelligence, including facial recognition technology. The BBC’s John Sudworth has been given rare access to one of the new hi-tech police control rooms.
http://www.bbc.com/news/av/world-asia-china-42248056/in-your-face-china-s-all-seeing-state
Watch the 5 min video.
20 posted on
12/14/2017 1:15:43 AM PST by
AdmSmith
(GCTGATATGTCTATGATTACTCAT)
To: BenLurkin
——the basic privacy rights-—
There is no such right in China.
One wonders if there is really such a right in America.
23 posted on
12/14/2017 11:38:40 AM PST by
bert
(K.E.; N.P.; GOPc;WASP .... The Fourth Estate is the Fifth Column)
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson