Free Republic
Browse · Search
News/Activism
Topics · Post Article

Skip to comments.

Donald Trump puts Australia on North Korean rocket alert (Ready to Intercept)
Daily Telegraph (Australia) ^ | April 10, 2017 | SHARRI MARKSON

Posted on 04/10/2017 6:59:57 PM PDT by TigerLikesRooster

Donald Trump puts Australia on North Korean rocket alert

SHARRI MARKSON, National Political Editor, The Daily Telegraph April 10, 2017 11:00pm

AUSTRALIA and its allies have been put on standby for the possibility of the United States shooting down test rockets launched by North Korea.

Intelligence sources told The Daily Telegraph that North Korea may launch ballistic missile test flights around the birthday of Kim II-sung, the founder of the rogue nation, on April 15 or even sooner.

The United States, which has a fleet headed to the Korean Peninsula, is understood to have notified Australia that it is fully prepared to shoot down these rockets. The Australian-United States joint facility at Pine Gap monitors North Korean missile launches, and is on standby.

(Excerpt) Read more at dailytelegraph.com.au ...


TOPICS: Australia/New Zealand; Breaking News; Foreign Affairs; Front Page News; News/Current Events
KEYWORDS: askrandpaulfirst; australia; congress; first100days; foreignpolicy; interventionism; nknukes; nkorea; randpaul; shootdown; trump; trump45; trumpasia
Navigation: use the links below to view more comments.
first previous 1-2021-4041-6061-72 last
To: TigerLikesRooster; nuconvert
A tablet to honor Andrei Karlov, former ambassador of the Russian Federation, was unveiled with due ceremony at the Russian embassy here on Monday.
Present there were Sin Hong Chol, vice-foreign minister of the DPRK, officials concerned, envoys and military attaches of foreign embassies, representatives of international bodies, Alexandr Matsegora, Russian ambassador to the DPRK, and his embassy officials, widow of Andrei Karlov and her party.
Speeches were made at the ceremony. The participants observed a moment's silence in memory of Andrei Karlov.
Then the table was unveiled. Written on it having the image of Karlov and Hero Medal in bold relief is the sentence that he, a Russian hero and diplomat, worked in the DPRK for his country.
http://www.rodong.rep.kp/en/index.php?strPageID=SF01_02_01&newsID=2017-04-11-0006

Karlov, who was very close to Putin, was killed in Istanbul last December, his son Gennady is working in the Russian embassy in NK. https://ru.wikipedia.org/wiki/%D0%9A%D0%B0%D1%80%D0%BB%D0%BE%D0%B2,_%D0%90%D0%BD%D0%B4%D1%80%D0%B5%D0%B9_%D0%93%D0%B5%D0%BD%D0%BD%D0%B0%D0%B4%D1%8C%D0%B5%D0%B2%D0%B8%D1%87 Maybe Fatty is of the opinion that Russia will save them?

61 posted on 04/11/2017 11:59:43 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 27 | View Replies]

To: Candor7
He needs to be careful he doesn't hit a crocodile, they can get very nasty.

It's a long way to Darwin.

62 posted on 04/11/2017 5:49:55 PM PDT by Fred Nerks (fair dinkum)
[ Post Reply | Private Reply | To 10 | View Replies]

To: Jumper

So one day both Iran and North Korea launched nuclear missles at the USA. On that day, Boston, SF, LA and Seattle were all hit and had millions of casualities. The city dwellers were blocked by those farmers in the heartlands, turning them back into the very hell they had created before the attacks to wither and die.>>>>>>>>>>>>>>>>>>>>

Sounds lie the makings of a good novel and movie!


63 posted on 04/12/2017 6:50:28 AM PDT by Candor7 ((Obama fascism article:(http://www.americanthinker.com/2009/05/barack_obama_the_quintessentia_1.html)
[ Post Reply | Private Reply | To 51 | View Replies]

To: Fred Nerks

Curious is it not, that the nuke tracking station for North Korea is located in the center of Australia at Pine Gap.Photos of the complex are available up thread.

I bet the tracking radars are very fast indeed.


64 posted on 04/12/2017 7:19:55 AM PDT by Candor7 ((Obama fascism article:(http://www.americanthinker.com/2009/05/barack_obama_the_quintessentia_1.html)
[ Post Reply | Private Reply | To 62 | View Replies]

To: Candor7

Looks like he could reach Darwin...

http://2.bp.blogspot.com/-dAZR2iG6T6c/TWFKZKKi2kI/AAAAAAAAAD8/_9YbRjtgHq0/s1600/dprk+-+missiles


65 posted on 04/12/2017 4:19:36 PM PDT by Fred Nerks (fair dinkum)
[ Post Reply | Private Reply | To 64 | View Replies]

To: Fred Nerks

Something Big League is about to happen.

The lefty public radio programs in Canada are going nuts about what is “about to happen” in North Korea.China has apparently amassed 150,000 troops along the NK border with China. No one klnows whether they will enter NK to support NK or to keep refugees from streaming into China.

The USS Carl Vinson task forth has Asia in a whizzy tizzy. The left’s meme is, Is Trump a mad man?

Well here we go. Gun boat diplomacy. I expect if NK fires missiles towards Japan on Fatty Frog’s birthday, they will be intercepted and shot down with a return salvo right back down the NK out going trajectories, thanks to the Pine Bluff radar station in Oz.

Fat Boy is about to get an adjustment if China does not rein him in.

The Japanese have sent several war ships to join the task force. This is looking like a show down for sure.

http://thediplomat.com/2017/04/japanese-warships-to-join-us-carrier-strike-group-off-korean-peninsula/

I am starting to stock pile a few supplies. In a few months things are likely to get expensive.Both my freezers are full and got lots of hunting paraphernalia.


66 posted on 04/12/2017 5:12:48 PM PDT by Candor7 ((Obama fascism article:(http://www.americanthinker.com/2009/05/barack_obama_the_quintessentia_1.html)
[ Post Reply | Private Reply | To 65 | View Replies]

To: Fred Nerks

Looks like he could reach Darwin...>>>>>>>>>

He just might be foolish enough.If so Pyong Yang will be a molten glowing crater in short order. Anything he shoots at the USA or Japan will be shot down.

The US nuclear subs to do the job are likely already in position.


67 posted on 04/12/2017 5:20:09 PM PDT by Candor7 ((Obama fascism article:(http://www.americanthinker.com/2009/05/barack_obama_the_quintessentia_1.html)
[ Post Reply | Private Reply | To 65 | View Replies]

To: TigerLikesRooster; nuconvert; AmericanInTokyo
Pyongyang took a swipe at long-standing ally China on Friday, implying that Beijing was “cooperating” with Washington for the collapse of North Korea, via an article in the Rodong Sinmun.

In the same article, Pyongyang also threatened to launch “nuclear thunderbolts” at the U.S., should Washington show any sign of a preemptive strike against the North.

While the report did not name China explicitly, both Presidents Donald Trump and Xi Jinping have discussed how to reign in North Korea recently.

“Currently, with the cooperation of ‘somebody,’ the U.S. is planning to collapse our system, the action that is such a naïve and foolish delusion,” the latter part of the Friday statement, released by the Institute for Disarmament and Peace (IDP) of the DPRK Foreign Ministry, said
https://www.nknews.org/2017/04/n-korea-criticizes-beijing-on-recent-chinese-u-s-cooperation/

SEOUL, April 14 (Yonhap) — China's top nuclear envoy appears to be pushing to visit North Korea following his trip to South Korea, but Pyongyang has yet to respond to the request, a diplomatic source in Seoul said Friday.

Wu Dawei is to leave for Beijing on Friday after a five-day stay in Seoul during which he met senior government officials and presidential candidates to discuss North Korea's nuclear and missile threats and the dispute over the deployment of a U.S. missile defense shield in South Korea.

“At this moment, it seems that Wu doesn't have a plan to go to the North,” the source said on condition of anonymity. “As far as I know, the North has not answered China's request for a visit.”

http://english.yonhapnews.co.kr/northkorea/2017/04/14/0401000000AEN20170414003851315.html

Fatty has problems.

68 posted on 04/14/2017 3:37:32 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 61 | View Replies]

To: AdmSmith
It may not even matter if he actually has a problem or not. The thing that really matters is whether he believes he has. If he does, the recent events are making impact on him as well as Chinese. I see it as a positive sign, but want to see more impact if we want to fundamentally change the current deplorable situation which has lasted long enough.
69 posted on 04/14/2017 3:55:46 AM PDT by TigerLikesRooster (dead parakeet + lost fishing gear = freep all day)
[ Post Reply | Private Reply | To 68 | View Replies]

To: TigerLikesRooster
Yes, it is the perceived situation that matters, but we shall not exclude that war is what Kim wants, “the shining path to the eruption of Mt Paektu”. A nuclear test tomorrow?
70 posted on 04/14/2017 4:11:53 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 69 | View Replies]

To: AdmSmith
We will see. I hope he sticks to his schedule. I hate to see smug devious Chinese regime in tandem with Kim to bump nuke test off for another month or two. One of these days I want to see their devious machination blow up in their face, because that is the only deterrent against their dangerous geopolitical agenda.
71 posted on 04/14/2017 4:25:03 AM PDT by TigerLikesRooster (dead parakeet + lost fishing gear = freep all day)
[ Post Reply | Private Reply | To 70 | View Replies]

To: Candor7

they will be intercepted and shot down with a return salvo right back down the NK out going trajectories, thanks to the Pine Bluff radar station in Oz.


With a little help from a whole fleet of high-tech satellites, I’m sure.


72 posted on 04/14/2017 2:34:17 PM PDT by samtheman (Trump++)
[ Post Reply | Private Reply | To 66 | View Replies]


Navigation: use the links below to view more comments.
first previous 1-2021-4041-6061-72 last

Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.

Free Republic
Browse · Search
News/Activism
Topics · Post Article

FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson