Free Republic
Browse · Search
News/Activism
Topics · Post Article

Skip to comments.

Russia Lies About Invading Ukraine as It Invades Ukraine
TDB ^ | 28 Aug 14 | Anna Nemtsova 

Posted on 08/29/2014 5:46:23 AM PDT by elhombrelibre

As Russia troops and tanks make an apparent bid to open the land route to annexed Crimea, discontent is growing in the motherland about the obvious but oft-denied war in Ukraine.

MOSCOW, Russia – Where U.S. President Barack Obama and German Chancellor Angela Merkel have failed to make Russian President Vladimir Putin acknowledge his ever-more-overt invasion of Ukraine and think about pulling back, Valentina Melnikova, the head of Russia’s famous Soldiers’ Mothers Committee, might just have a chance.

Early Thursday morning, Melnikova started getting phone calls from Russian army bosses. All of them, from the deputy defense minister to the paratrooper division commanders, wanted to meet with the great matriarch of the Russian military. She had accused the entire high command, along with Commander-in-Chief Vladimir Putin of invading Ukraine and of committing a crime against Russian citizens by sending Russian soldiers to "the bloody battlefields" without declaring the war, without signing legal papers with the servicemen, without letting Russian mothers know where exactly their drafted sons ended up dying.

The day before, Russian servicemen were fighting shoulder to shoulder with pro-Russian separatists in Novoazovsk, a strategic port city on the Russian border. By taking over Novoazovsk, the separatists cleared the way for more servicemen to pour into Ukraine. “According to our expert analyses,” said Melnikova – and few organizations have better information than hers – “ there are over 10,000 Russian soldiers fighting in Ukraine today."

(Excerpt) Read more at thedailybeast.com ...


TOPICS: Breaking News; Crime/Corruption; Foreign Affairs; Russia
KEYWORDS: novoazovsk; putin; russia; ukraine
Navigation: use the links below to view more comments.
first previous 1-2021-4041-6061-65 next last
To: ansel12
Like so many of these threads, if the posters don’t want to openly defend the new Soviet Putin, then they turn the thread into an anti-America thread, or anti-Obama thread as an indirect way of diluting or sidetracking criticism of the Russian goals they support.

And then complain when they are called names.

21 posted on 08/29/2014 9:30:29 AM PDT by 1rudeboy
[ Post Reply | Private Reply | To 14 | View Replies]

To: elhombrelibre

And by damning America, as if they were from the Reverend Wright’s church, these Putinistas show they’re more loyal to Putin than they are to the USA


So we should go to war with Russia to prove our “loyalty?” Screw that. LET Putin have the Ukraine. The world didn’t stop going around when the USSR had it. Europe doesn’t give a damn if Russia takes it, so why should we waste lives and treasure over it?


22 posted on 08/29/2014 9:34:00 AM PDT by chessplayer
[ Post Reply | Private Reply | To 15 | View Replies]

To: chessplayer

I’m sure we can both agree that there is a difference between damning America and praising Putin’s immoral and illegal war on Ukraine, a country that has not provoked a war. And it’s simply absurd to think that the we either must go to war with Putin or damn American and praise Putin.


23 posted on 08/29/2014 9:55:10 AM PDT by elhombrelibre (Against Obama. Against Putin. Pro-freedom. Pro-US Constitution.)
[ Post Reply | Private Reply | To 22 | View Replies]

To: Slings and Arrows

OH Man I miss that guy Baghdad Bob whatever happen to him now I understand he went to Russia LOL!


24 posted on 08/29/2014 9:57:02 AM PDT by SevenofNine (We are Freepers, all your media bases belong to us ,resistance is futile)
[ Post Reply | Private Reply | To 2 | View Replies]

To: elhombrelibre

I have not seen one person say we should go to war with Russia. I am very much in favor of helping Ukraine and sending them new weapons and equipment. I even opposed the “sanctions/trade war” with Russia as stupid, it does nothing to help Ukraine.


25 posted on 08/29/2014 9:57:25 AM PDT by GeronL (Vote for Conservatives not for Republicans)
[ Post Reply | Private Reply | To 23 | View Replies]

To: GeronL

I agree. That’s a red herring stated to imply that there is no alternative to appeasement and letting the bully have his way. A lot of the sophistries we read in support of Putin are really weak.


26 posted on 08/29/2014 10:03:31 AM PDT by elhombrelibre (Against Obama. Against Putin. Pro-freedom. Pro-US Constitution.)
[ Post Reply | Private Reply | To 25 | View Replies]

FReepers, Let's go!
Everyone needs to donate.


All contributions are for the current quarter expenses.


27 posted on 08/29/2014 10:07:33 AM PDT by RedMDer (May we always be happy and may our enemies always know it. - Sarah Palin, 10-18-2010)
[ Post Reply | Private Reply | View Replies]

To: chessplayer

Who told you Europe/NATO doesn’t care about Russia taking Ukraine?


28 posted on 08/29/2014 10:30:12 AM PDT by ansel12 (LEGAL immigrants, 30 million 1980-2012, continues to remake the nation's electorate for democrats)
[ Post Reply | Private Reply | To 22 | View Replies]

To: elhombrelibre
I think what's worse is the invasion that our administration insists isn't taking place that is taking place.
29 posted on 08/29/2014 10:37:17 AM PDT by BradyLS (DO NOT FEED THE BEARS!)
[ Post Reply | Private Reply | To 1 | View Replies]

To: chessplayer

I’m with you. No use losing any sleep over Russia’s steady re-annexation of Ukraine if our own elites can’t be bothered about Mexico’s steady re-annexation of the American Southwest.


30 posted on 08/29/2014 10:42:55 AM PDT by BradyLS (DO NOT FEED THE BEARS!)
[ Post Reply | Private Reply | To 22 | View Replies]

To: elhombrelibre

Instead of creating WWIII Putin should have worked on Russia’s economy which would have helped his people. This little man is just as insane as Hitler was and he eventually will put Russia in the trash heap. This little man says he has nukes? What? Damn what a stupid nitwit. Most of the damn world has them and what does this idiot think our armament is?


31 posted on 08/29/2014 11:35:44 AM PDT by Logical me
[ Post Reply | Private Reply | To 1 | View Replies]

To: SevenofNine

He’s in good form, too.


32 posted on 08/29/2014 1:21:59 PM PDT by Slings and Arrows ("Your Daddy Was Drunk and Your Mama Was Lonely" - http://youtu.be/4HYy62qiOwA)
[ Post Reply | Private Reply | To 24 | View Replies]

To: Slings and Arrows

Baghdad Bob is best thing during Iraqi war

He was good I wonder why he never sign with US network that be so cool better than Brian William sometime


33 posted on 08/29/2014 1:57:32 PM PDT by SevenofNine (We are Freepers, all your media bases belong to us ,resistance is futile)
[ Post Reply | Private Reply | To 32 | View Replies]

To: SevenofNine

The other talking heads would be jealous of his mad skillz.


34 posted on 08/29/2014 2:04:04 PM PDT by Slings and Arrows ("Your Daddy Was Drunk and Your Mama Was Lonely" - http://youtu.be/4HYy62qiOwA)
[ Post Reply | Private Reply | To 33 | View Replies]

To: elhombrelibre
What?
Commies NEVER lie.
Period!!!
35 posted on 08/29/2014 2:41:52 PM PDT by Amagi (Lenin: "Socialized Medicine is the Keystone to the Arch of the Socialist State.")
[ Post Reply | Private Reply | To 1 | View Replies]

To: elhombrelibre
Russia Lies About Invading Ukraine as It Invades Ukraine

Obama Lies About Defending Our Border As He Works On Amnesty For All

36 posted on 08/29/2014 9:10:25 PM PDT by OrangeHoof (Every time you say no to a liberal, you make the Baby Barack cry.)
[ Post Reply | Private Reply | To 1 | View Replies]

To: OrangeHoof

I always find responses like yours just plain weird. I know Obama lies. Why does that make it okay for Putin to lie about invading a country because Obama lies about defending our border? I’m not trying to achieve utopia by saying one lie doesn’t make the other acceptable. Like your mother probably told you, “Two wrongs don’t make a right.”


37 posted on 08/29/2014 11:34:39 PM PDT by elhombrelibre (Against Obama. Against Putin. Pro-freedom. Pro-US Constitution.)
[ Post Reply | Private Reply | To 36 | View Replies]

To: elhombrelibre; SunkenCiv; gandalftb; nuconvert; TigerLikesRooster; Greetings_Puny_Humans; GeronL; ..
This will work:

U.K. Wants EU to Block Russia From SWIFT Banking Network http://www.bloomberg.com/news/2014-08-29/u-k-wants-eu-to-block-russia-from-swift-banking-network.html

and increase the oil production:

The main cause for the recent fall in oil prices is that weakening demand is being met by rising production. West African crude exports to Asia were near record levels in September, a Reuters survey of traders showed, and the North Sea market remained well supplied.

Production from the Organization of the Petroleum Exporting Countries (OPEC) rose, despite conflicts in Iraq and Libya.
OPEC, which supplies a third of the world's oil, raised its output in August from July, with higher supply from Libya, Angola and Iran, a Reuters survey found.

http://www.dailytimes.com.pk/business/30-Aug-2014/brent-oil-rises-on-ukraine-crisis-but-heads-for-monthly-fall

the result will be this:

“With the significant deterioration in the Ukrainian situation, markets may treat this as a Lehman-style shock,” Kantarovich wrote in an e-mailed report Friday. “Revisiting the post-Lehman lows would imply downside of 50 percent from an index perspective.”

The bank recommends reducing Russian investments because “markets may no longer assume a quick and easy resolution of the conflict and ‘worse before better’ seems a likely sequence.”

http://www.Newsmax.com/Finance/JPMorgan-Russia-Ukraine-stocks/2014/08/29/id/591641

38 posted on 08/30/2014 2:03:39 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 1 | View Replies]

To: elhombrelibre
I’m sure the dictator in Russia appreciates you clearing up the moral differences for them

And I'm sure the dictator in the WH appreciates you taking that slant on my comment.

39 posted on 08/30/2014 2:22:01 AM PDT by trebb (Where in the the hell has my country gone?)
[ Post Reply | Private Reply | To 16 | View Replies]

To: elhombrelibre

Why should we care that other leaders lie when our own leaders are worse?


40 posted on 08/30/2014 7:41:38 AM PDT by OrangeHoof (Every time you say no to a liberal, you make the Baby Barack cry.)
[ Post Reply | Private Reply | To 37 | View Replies]


Navigation: use the links below to view more comments.
first previous 1-2021-4041-6061-65 next last

Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.

Free Republic
Browse · Search
News/Activism
Topics · Post Article

FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson