Free Republic
Browse · Search
News/Activism
Topics · Post Article

Can this be a repeat of Cairo?
1 posted on 02/14/2011 1:31:56 AM PST by AdmSmith
[ Post Reply | Private Reply | View Replies ]


Navigation: use the links below to view more comments.
first 1-2021-28 next last
To: SunkenCiv; nuconvert

Iranian security forces blocked the entrance to the house of opposition leader Mir Hussein Mousavi and cut off the telephone lines in his home to prevent him from attending the opposition protest in support of the Egypt and Tunisia protests scheduled for Monday, an opposition website reported.

According to the report, several police vehicles are blocking the entrance to Mousavi’s house in Tehran. Another opposition leader Mehdi Karoubi has been in effective house arrest since Thursday.

http://www.ynetnews.com/articles/0,7340,L-4028265,00.html


2 posted on 02/14/2011 1:33:35 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 1 | View Replies ]

To: AdmSmith

Can’t wait for Obama’s resolute moment (Take 2).


4 posted on 02/14/2011 1:36:47 AM PST by Gene Eric (Your Hope has been redistributed. Here's your Change.)
[ Post Reply | Private Reply | To 1 | View Replies ]

To: AdmSmith

It’s fascinating to me that in 2009 this administration offered NO support to the demonstrators in Iran- in fact- just the opposite. Yet last week Joe Biden called on Iran to join the party with Egypt...encouraged the people to rise up. Either we’re helping behind the scenes or Biden is about to have blood on his hands.


20 posted on 02/14/2011 2:16:54 AM PST by SE Mom (Proud mom of an Iraq war combat vet)
[ Post Reply | Private Reply | To 1 | View Replies ]

To: AdmSmith
From Adams links.

2:50 p.m. Confirmed: The Interior Ministry has issued a permit for the Tehran march.

Unconfirmed: Reports that Turkish President Abdullah Gul will join the protesters in Tehran.

Unconfirmed: Reports that Gul asked the government of Iran to give the protesters the permit to demonstrate and the government succumbed to his demands.

That will certainly change the dynamics of the situation if it's true.

If they can turn Iran my thoughts on Egypt will improve considerably.

 popcorn.JPG

30 posted on 02/14/2011 3:46:05 AM PST by ResearchMonkey (Holding Conservative Country in California.)
[ Post Reply | Private Reply | To 1 | View Replies ]

To: AdmSmith

watching closely... thanks for the REALtime updates


35 posted on 02/14/2011 4:00:47 AM PST by davidosborne (2012 will be the year of the INDEPENDENT CONSERVATIVE ! let's GOOOH !)
[ Post Reply | Private Reply | To 1 | View Replies ]

To: Uncle Ike; HollyB; onyx; maggief; Liz; penelopesire; HushTX; McGruff; hegemony; sunmars; ...

Pinging Egypt list for Iran protest.


48 posted on 02/14/2011 4:33:42 AM PST by SE Mom (Proud mom of an Iraq war combat vet)
[ Post Reply | Private Reply | To 1 | View Replies ]

To: AdmSmith

@iranian: Unconfirmed: reports saying that a huge crowd is moving from Ferdowsi Square toward Valiasr Intersection #iran #25bahman
5 minutes ago via Twitterrific

@MikVerbrugge: #Iran #25Bahman witness:2:15pm near Sanati U. Security Forces tried entering Azadi Sq but ppl blocked roads with their cars
5 minutes ago via TweetDeck


49 posted on 02/14/2011 4:36:05 AM PST by SE Mom (Proud mom of an Iraq war combat vet)
[ Post Reply | Private Reply | To 1 | View Replies ]

To: AdmSmith

Bump


52 posted on 02/14/2011 5:18:53 AM PST by nuconvert ( Khomeini promised change too // Hail, Chairman O)
[ Post Reply | Private Reply | To 1 | View Replies ]

To: AdmSmith
"Everybody just chill!"


55 posted on 02/14/2011 5:20:11 AM PST by paulycy (Islamo-Marxism is Evil.)
[ Post Reply | Private Reply | To 1 | View Replies ]

To: AdmSmith

Come on, Baraqqi. Let’s hear the rhetoric about ‘young people clamoring for change’.

I won’t hold my breath.


60 posted on 02/14/2011 5:34:21 AM PST by Colonel_Flagg ("It's hard to take the president seriously." - Jim DeMint)
[ Post Reply | Private Reply | To 1 | View Replies ]

To: AdmSmith; All

http://www.newsnow.co.uk/h/World+News/Middle+East/Iran ... May this news link help keep All close to current.


64 posted on 02/14/2011 5:42:27 AM PST by no-to-illegals (Please God, Bless and Protect Our Men and Women in Uniform with Victory. Amen.)
[ Post Reply | Private Reply | To 1 | View Replies ]

To: AdmSmith

5:05 p.m. More reports coming in of Isfahan protests, and now confirmation of protests in Kermanshah, as well. Estimates in those two cities and Shiraz are of thousands of participants.

And we’ve confirmed from multiple sources that tear gas was indeed used in Tehran’s Valiasr Square to disperse protesters. Additional clashes are being reported there.

Hafte Tir Square has also been taken over by security forces like Azadi Square and protesters are finding it difficult to navigate through.

Thousands are silently marching on Enghelab Avenue toward Azadi Square. Clashes are breaking out along the route, with protesters being beaten by security forces, but the silent march continues.


65 posted on 02/14/2011 5:57:31 AM PST by nuconvert ( Khomeini promised change too // Hail, Chairman O)
[ Post Reply | Private Reply | To 1 | View Replies ]

To: AdmSmith

There’s no tv coverage here. Coverage of the Grammys, Fashion week and Valentine’s Day are much more important.

If there was no coverage of the demonstrations in Egypt, Mubarak would be running things as usual this morning.


67 posted on 02/14/2011 6:00:36 AM PST by nuconvert ( Khomeini promised change too // Hail, Chairman O)
[ Post Reply | Private Reply | To 1 | View Replies ]

To: AdmSmith; davidosborne

Prayers and best wishes to the people of Iran for their freedom. Down with the dictator!

All Saints of Persia, pray for your people! Most Holy Theotokos, pray for Iran!!!!


68 posted on 02/14/2011 6:16:20 AM PST by Honorary Serb (Kosovo is Serbia! Free Srpska! Abolish ICTY!)
[ Post Reply | Private Reply | To 1 | View Replies ]

Iran Standard Time (IRST), GMT+3:30

5:25 p.m. Iranian journalist and blogger Reza Valizadeh, now based in Paris, reports, “Gatherings of protesters in Revolution Sq; 7th Tir Sq; Ferdousi Sq; Sadeghieh Sq. and Vali Asr crosspoint and attack by special forces has been confirmed.” There are also reports of clashes at Sharif Industrial University and of the arrest of several students there.

Kaleme and Saham News — the websites, respectively, of Mousavi and Karroubi’s National Trust Party — are both down.

Rahe Sabz is reporting that riot police are mostly being used to control the protests. Not equipped with firearms, they are using their batons and shields to corner and disperse demonstrators.

The largest gatherings of protesters are near College Square, Valiasr Square, and around Azadi and Enghelab Squares. There are also reports of more protesters moving from College Bridge toward Enghelab Square. Security forces are present in most other parts of central Tehran and are trying to stop protesters from gathering there. Though Azadi Square, the intended endpoint of the march, is filled with security forces, many protesters have made it there and are waiting for others who are still on Enghelab Avenue and trying to reach the square.


69 posted on 02/14/2011 6:18:01 AM PST by nuconvert ( Khomeini promised change too // Hail, Chairman O)
[ Post Reply | Private Reply | To 1 | View Replies ]

To: AdmSmith
Repeat performances 24 hours later in Yemen's capital, Sana'a, at Sana'a University and Tahrir Square..calls for "Ali Abdullah Saleh to step down!" and another “day of rage” protest in Algiers.. "Bouteflika, out"!
83 posted on 02/14/2011 7:26:54 AM PST by fight_truth_decay
[ Post Reply | Private Reply | To 1 | View Replies ]

To: AdmSmith

Al Jazeera

87 posted on 02/14/2011 7:34:30 AM PST by fight_truth_decay
[ Post Reply | Private Reply | To 1 | View Replies ]

To: AdmSmith

No, it can’t.

Regardless of the similarities, no uprising in any nation is ever a repeat of another.

That said, we can certainly hope there is a similar outcome. I’d LOVE to see Iran’s current regime fall, and fall hard.


100 posted on 02/14/2011 8:16:23 AM PST by HushTX (If the best defense is a good offense, it's a good thing I'm really offensive.)
[ Post Reply | Private Reply | To 1 | View Replies ]

http://latimesblogs.latimes.com/babylonbeyond/2011/02/iran-more-video-footage-from-protest-rallies-show-demonstrators-marching-in-tehran.html


101 posted on 02/14/2011 8:19:03 AM PST by nuconvert ( Khomeini promised change too // Hail, Chairman O)
[ Post Reply | Private Reply | To 1 | View Replies ]

To: AdmSmith
IRAN: Protesters fill streets of Tehran chanting by the thousands via Videos
111 posted on 02/14/2011 8:38:29 AM PST by fight_truth_decay
[ Post Reply | Private Reply | To 1 | View Replies ]


Navigation: use the links below to view more comments.
first 1-2021-28 next last

Free Republic
Browse · Search
News/Activism
Topics · Post Article


FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson