Free Republic
Browse · Search
News/Activism
Topics · Post Article

Skip to comments.

Iran Live Blog: 25 Bahman / 14 February
Tehrean Bureau ^ | 14 Feb 2011 | several

Posted on 02/14/2011 1:31:52 AM PST by AdmSmith

What will happen Monday, history will record in less than 24 hours. The atmosphere is filled by suspense over the call for demonstration. Certainly the city is not calm. There were chants of "Allah-o akbar" across Tehran. People expect something to happen. Publicly, Mr. Karroubi and Mr. Mousavi have called for a demonstration in solidarity with the people of Egypt. Nobody thinks or believes this is about Egypt or will remain focused on Egypt. No wonder that their request has been rejected as illegal. Their advisers have announced that according to Article 27 of Iran's Constitution there is no need for a permit. It must be noted that both leaders are under house arrest now. Most likely they will be prevented from attending the demonstration. [While Karroubi has been under house arrest for four days, there is no independent confirmation that Mousavi has been similarly confined. As we noted two-and-a-half hours ago, a senior adviser to the former presidential candidate says that his mobile phone has been disconnected and it has not been possible to reach him. --Ed.]

(Excerpt) Read more at pbs.org ...


TOPICS: Breaking News; Foreign Affairs
KEYWORDS: 25bahman; cnn; demonstration; iran; iranprotest; islam; mediabias; nicrobertson; spartansixdelta
Navigation: use the links below to view more comments.
first 1-2021-4041-6061-80 ... 201-208 next last
Can this be a repeat of Cairo?
1 posted on 02/14/2011 1:31:56 AM PST by AdmSmith
[ Post Reply | Private Reply | View Replies]

To: SunkenCiv; nuconvert

Iranian security forces blocked the entrance to the house of opposition leader Mir Hussein Mousavi and cut off the telephone lines in his home to prevent him from attending the opposition protest in support of the Egypt and Tunisia protests scheduled for Monday, an opposition website reported.

According to the report, several police vehicles are blocking the entrance to Mousavi’s house in Tehran. Another opposition leader Mehdi Karoubi has been in effective house arrest since Thursday.

http://www.ynetnews.com/articles/0,7340,L-4028265,00.html


2 posted on 02/14/2011 1:33:35 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 1 | View Replies]

To: AdmSmith

Iran Standard Time (IRST), GMT+3:30
12:50 a.m. Tehran Bureau contributor homylafayette reports that the web is buzzing with stories of a protester who climbed a crane near Chahar Raheh Ghasr and hoisted a flag at around 8:30 a.m. The protester held up pictures of “martyrs” and warned authorities that they would jump if approached.


3 posted on 02/14/2011 1:36:03 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 2 | View Replies]

To: AdmSmith

Can’t wait for Obama’s resolute moment (Take 2).


4 posted on 02/14/2011 1:36:47 AM PST by Gene Eric (Your Hope has been redistributed. Here's your Change.)
[ Post Reply | Private Reply | To 1 | View Replies]

To: Gene Eric

Emruz News, the website close to the reformist Organization of Islamic Revolution Mojahedin, quoting Al-Arabiyah, reported that credible sources in Tehran have said that security forces have been ordered not to confront the marches if they are sizable, but simply try to control them.

Emruz News also reported that in the meeting of Iran’s Supreme National
Security Council, Major General Mohammad Ali Jafari, the Revolutionary Guard commander, has expressed concern that the Guard’s rank and file may disobey the orders of their superiors, if directed to employ violence against marchers. Given that the Egyptian army did not open fire on the demonstrators in Cairo, a violent crackdown on Monday’s marches may completely destroy the credibility of the force with the people. Thus, he proposed that the police be made responsible fro imposing order Monday marches, instead of Basij and Guard forces.

http://www.pbs.org/wgbh/pages/frontline/tehranbureau/2011/02/wave-of-support-for-demonstrations-on-february-14.html


5 posted on 02/14/2011 1:40:54 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 4 | View Replies]

To: AdmSmith

High noon Tehran Time. 3 hours till anticipated march time


6 posted on 02/14/2011 1:49:54 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 5 | View Replies]

Many people have started to gather in Sadeghya Square in Tehran


7 posted on 02/14/2011 1:52:52 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 6 | View Replies]

To: AdmSmith
With no international/outside 24/7 Wurlitzer type media support to the level such as the Islmamofascists got in Cairo via BBC, Al Jazeera, Facebook, CNN, CBS, NBC, ABC, MSNBC, Al Arabiya, NYT, WashPost, LATimes, NPR, etc. etc., I don't know how the TRUE FREEDOM FIGHTERS taking on Fundamental Islamism, such as in Iran, can get anywhere as far in 18 days. I just hope they are not shot down in the streets.

Obongo would get on there and ask us all to not make too many rash judgments about massacres in Teheran, that's for sure.

(Still have not figured out if Obama is Sunni or Shiite...perhaps Wahabbist, I reckon.)

8 posted on 02/14/2011 1:52:57 AM PST by AmericanInTokyo (The issue? "Responsibility" for this mess. Obama ? Or the AMERICAN PEOPLE for putting him in there?)
[ Post Reply | Private Reply | To 5 | View Replies]

To: AmericanInTokyo

about 50 riot police in bikes were headed toward Azadi Square. Another 100 are at Ferdowsi square. No protests yet


9 posted on 02/14/2011 1:53:52 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 8 | View Replies]

To: AdmSmith

Many People will be on the streets within the next 2 hours


10 posted on 02/14/2011 1:54:56 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 9 | View Replies]

To: AdmSmith

The internet speed is quite low in Tehran. Still functioning tho!


11 posted on 02/14/2011 1:55:52 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 10 | View Replies]

To: AdmSmith

A reliable source says many IRGC commanders have refused to take charge today. Their argument to the Supreme National Security Council is that it’s a job for regular Security Forces, not IRGC combat brigades.

http://www.twitlonger.com/show/8ql5tn


12 posted on 02/14/2011 1:56:51 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 11 | View Replies]

To: AdmSmith

State Department starts Farsi Twitter feed


13 posted on 02/14/2011 1:58:46 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 12 | View Replies]

To: AdmSmith
Security forces have told all shopkeepers of Enghelab sq to close down by 3 p.m. http://www.astreetjournalist.com/2011/02/14/minute-by-minute-reports-of-february-14-25-bahman-گزارش-لحظه-به-لحظه-از-راهپیم/
14 posted on 02/14/2011 2:00:31 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 13 | View Replies]

To: AdmSmith

According to one police commander, around 2:00 p.m., officers from different precincts will be stationed along the demonstration route. They are particularly to be stationed in front of banks and gas stations as well public buildings. These forces are ordered TO AVOID any clash with the demonstrators and only interfere to PREVENT VIOLENCE. Anti-riot forces and Basij units are on alert and will be stationed in alleys and parking areas. The traffic police force will be focused on the major intersection of Roudaki St. and Azadi Blvd. It should be kept in mind that there is a strong possibility that the demonstrators will be attacked and shot at after the demonstration ends. It is absolutely necessary to disperse when the demonstration is done. All the bookstores and other stores in the University of Tehran district (Enghelab Square) are ordered to shut down at 2:00 p.m.

http://behzad-mani.blogfa.com/post-77.aspx


15 posted on 02/14/2011 2:03:36 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 14 | View Replies]

To: AdmSmith

check out the video
http://greenrevolutioniran.blogspot.com/2011/02/blog-post_5452.html


16 posted on 02/14/2011 2:06:13 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 15 | View Replies]

To: AdmSmith
Here is a pic this a.m. (early evening our time, afternoon Teheran) of those guys that got up on top of that big construction crane:


17 posted on 02/14/2011 2:06:21 AM PST by AmericanInTokyo (The issue? "Responsibility" for this mess. Obama ? Or the AMERICAN PEOPLE for putting him in there?)
[ Post Reply | Private Reply | To 13 | View Replies]

To: AmericanInTokyo

some training
How to defend against a baseball bat in a street fight
http://www.youtube.com/watch?v=onF2hnmn3hk


18 posted on 02/14/2011 2:13:42 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 17 | View Replies]

To: AmericanInTokyo

some training
How to defend against a baseball bat in a street fight
http://www.youtube.com/watch?v=onF2hnmn3hk


19 posted on 02/14/2011 2:13:51 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 17 | View Replies]

To: AdmSmith

It’s fascinating to me that in 2009 this administration offered NO support to the demonstrators in Iran- in fact- just the opposite. Yet last week Joe Biden called on Iran to join the party with Egypt...encouraged the people to rise up. Either we’re helping behind the scenes or Biden is about to have blood on his hands.


20 posted on 02/14/2011 2:16:54 AM PST by SE Mom (Proud mom of an Iraq war combat vet)
[ Post Reply | Private Reply | To 1 | View Replies]


Navigation: use the links below to view more comments.
first 1-2021-4041-6061-80 ... 201-208 next last

Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.

Free Republic
Browse · Search
News/Activism
Topics · Post Article

FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson