Free Republic
Browse · Search
News/Activism
Topics · Post Article

To: Gene Eric

Emruz News, the website close to the reformist Organization of Islamic Revolution Mojahedin, quoting Al-Arabiyah, reported that credible sources in Tehran have said that security forces have been ordered not to confront the marches if they are sizable, but simply try to control them.

Emruz News also reported that in the meeting of Iran’s Supreme National
Security Council, Major General Mohammad Ali Jafari, the Revolutionary Guard commander, has expressed concern that the Guard’s rank and file may disobey the orders of their superiors, if directed to employ violence against marchers. Given that the Egyptian army did not open fire on the demonstrators in Cairo, a violent crackdown on Monday’s marches may completely destroy the credibility of the force with the people. Thus, he proposed that the police be made responsible fro imposing order Monday marches, instead of Basij and Guard forces.

http://www.pbs.org/wgbh/pages/frontline/tehranbureau/2011/02/wave-of-support-for-demonstrations-on-february-14.html


5 posted on 02/14/2011 1:40:54 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 4 | View Replies ]


To: AdmSmith

High noon Tehran Time. 3 hours till anticipated march time


6 posted on 02/14/2011 1:49:54 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 5 | View Replies ]

To: AdmSmith
With no international/outside 24/7 Wurlitzer type media support to the level such as the Islmamofascists got in Cairo via BBC, Al Jazeera, Facebook, CNN, CBS, NBC, ABC, MSNBC, Al Arabiya, NYT, WashPost, LATimes, NPR, etc. etc., I don't know how the TRUE FREEDOM FIGHTERS taking on Fundamental Islamism, such as in Iran, can get anywhere as far in 18 days. I just hope they are not shot down in the streets.

Obongo would get on there and ask us all to not make too many rash judgments about massacres in Teheran, that's for sure.

(Still have not figured out if Obama is Sunni or Shiite...perhaps Wahabbist, I reckon.)

8 posted on 02/14/2011 1:52:57 AM PST by AmericanInTokyo (The issue? "Responsibility" for this mess. Obama ? Or the AMERICAN PEOPLE for putting him in there?)
[ Post Reply | Private Reply | To 5 | View Replies ]

Free Republic
Browse · Search
News/Activism
Topics · Post Article


FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson