Free Republic
Browse · Search
News/Activism
Topics · Post Article

Tried to post the Wired story but that site is blocked as a source.

Possible bluff, but it's not like anybody in this administration will call him on it. Further even without the "insurance" I saw nothing to make me think anybody would move against him regardless.

Apparently though he has been stung by those who say he is getting Afghani informants killed.

1 posted on 08/01/2010 2:55:42 AM PDT by tlb
[ Post Reply | Private Reply | View Replies ]


To: tlb; SunkenCiv
1.4 gigabytes encrypted by AES256, this must be a magnet for all Sigint organizations in the whole world.

How could a 22-year old get TS clearance??? and why was the data that he processed not compartmentalized?

2 posted on 08/01/2010 3:34:25 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 1 | View Replies ]

To: tlb

The man is either a stupid fool or writer has it wrong. No encryption software exists today that the government can’t break in a few days with their massively parallel arrayed decryption computers.


4 posted on 08/01/2010 3:41:40 AM PDT by BushCountry (I spoken many wise words in jest, but no comparison to the number of stupid words spoken in earnest)
[ Post Reply | Private Reply | To 1 | View Replies ]

To: tlb

I wish Wikileaks would do something patriotic FOR the USA, expose Obamas past, his history, all his credential, the entire enchilada, from the Dunham side of the family selling B-29 plans to the Russians to the connections of the American Communist party and rumored financial backing from Castro and his 50 years dream of ultimate revenge upon America.


6 posted on 08/01/2010 3:43:01 AM PDT by Eye of Unk ("In a time of universal deceit, telling the truth becomes a revolutionary act" G.Orwell)
[ Post Reply | Private Reply | To 1 | View Replies ]

To: tlb

this guy needs to get acquainted with the business end of a Mossad hushpuppy


7 posted on 08/01/2010 3:43:48 AM PDT by LeoWindhorse
[ Post Reply | Private Reply | To 1 | View Replies ]

To: tlb; All

I’d love to hear from any legal experts on the forum if this guy can hypothetically be tried for treason and sentenced to the death penalty if found guilty. Although not likely to happen with this administration, I’d still like to know if it’s possible.

For the sake of national security though, it would be good if he disappeared.


9 posted on 08/01/2010 3:51:49 AM PDT by Rammer
[ Post Reply | Private Reply | To 1 | View Replies ]

To: tlb

Assange is not just ni fear of US government. The Aussie military intelligence hierarchy have been hounding him weeks before he first announced the preannouncement of the big leak.

Fair to say the military intelligence in the Anglosphere and Commonwealth all have him on their radar.


18 posted on 08/01/2010 4:59:19 AM PDT by JerseyHighlander
[ Post Reply | Private Reply | To 1 | View Replies ]

To: tlb

“WikiLeak Blackmails US and Blames US for Dead Informants”

He’s engaging in the same tactics used by Democrats.
(Another ally of the Democrat Party.)

IMHO


21 posted on 08/01/2010 5:16:29 AM PDT by ripley
[ Post Reply | Private Reply | To 1 | View Replies ]

To: tlb

I read some of these action reports yesterday. Hard to see how the vast bulk of what I read could be of use to the enemy. Maybe some names in there, but I did not see any.

It’s also very hard to see how this is going to galvanize opposition to the war.

I think this guy’s efforts are as likely to escalate the war as help bring it to an end. Neither is very likely, but it would be interesting if his efforts backfired and actually caused an escalation of the war.


22 posted on 08/01/2010 5:17:17 AM PDT by Brilliant
[ Post Reply | Private Reply | To 1 | View Replies ]

To: tlb

bookmark for later read


24 posted on 08/01/2010 5:31:50 AM PDT by IllumiNaughtyByNature (3(0|\|0/\/\1($ 101: (4P174L1$/\/\ R3QU1r3$ (4P174L. Could it be any more simple?)
[ Post Reply | Private Reply | To 1 | View Replies ]

To: tlb

No sympathy with Assange, but the trick of posting encrypted information on the web to discourage official retribution may be useful for others with more worthy causes.


28 posted on 08/01/2010 5:49:35 AM PDT by Grut
[ Post Reply | Private Reply | To 1 | View Replies ]

To: tlb
Assange told reporters that he has plenty more material to be published, including “very significant” information on the BP oil spill and abuses in the US military, including sexual abuse.

Would he happen to have any birth certificates in his file?

30 posted on 08/01/2010 5:51:35 AM PDT by Mannaggia l'America
[ Post Reply | Private Reply | To 1 | View Replies ]

To: tlb

Was Wikileaker Bradley Manning Betrayed By His Queer Identity?

Was Wikileaker Bradley Manning Betrayed By His Queer Identity?It’s been speculated that alleged Army leaker, PFC Bradley Manning, is transgendered. We’ve found evidence that strongly suggests Manning has some sort of LGBT identity, and that the man who snitched on him exploited this to win his trust.

Twenty-two year-old army intelligence specialist Bradley Manning was arrested May 26th for allegedly leaking the notorious Iraq Apache attack helicopter video and more than a quarter million classified State Department documents to secret-sharing website Wikileaks. He was turned in by his confidant, ex-hacker Adrian Lamo. Lamo then gave logs of his chats with Manning to Wired’s Kevin Poulsen, who broke the story of Manning’s arrest.

There are many unanswered questions about this story—the largest of which is: Why would Manning trust an ex-hacker he had never met enough to confess, almost immediately, via instant message, his terrible Wikileaks secret—something he knew could put him in prison for a long time? Lamo told Salon that Manning found him by doing a Twitter search for “Wikileaks,” and that he doesn’t know what motivated his confession. Yeah fucking right.

Wired suggested Manning sensed a “kindred-spirit in the ex-hacker” Lamo. But Manning and Lamo also apparently share something stronger than a fondness for breaking into computer systems: An LGBT identity. Lamo is an out bisexual, while an increasing number of clues suggest that Manning is, if not transgendered, deeply uncertain about his sexuality and/or gender. Interviews with Lamo’s acquaintances and a close reading of the chat logs suggest Lamo traded on this identity to exploit Manning at his most vulnerable, as questions about his sexuality were unbearably pressing on his personal and professional lives......

http://gawker.com/5571388/was-wikileaker-bradley-manning-betrayed-by-his-queer-identity


34 posted on 08/01/2010 7:22:37 AM PDT by KeyLargo
[ Post Reply | Private Reply | To 1 | View Replies ]

To: tlb
Julian Assange has uploaded a file called “insurance” to the website and elsewhere. The file is 1.4 gigabytes, a thousand times larger than the recently leaked documents.

It is estimated that even the fastest computer would take millions of years to decrypt the file.

Textbook example for a non sequitur.

The file size has absolutely nothing to do with how long it would take to break the encryption code. A 1kB file encrypted with the same key would take exactly as long to decrypt.

41 posted on 08/01/2010 10:35:10 AM PDT by Moltke (panem et circenses)
[ Post Reply | Private Reply | To 1 | View Replies ]

Free Republic
Browse · Search
News/Activism
Topics · Post Article


FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson