Free Republic
Browse · Search
News/Activism
Topics · Post Article

Skip to comments.

WikiLeaks founder uploads mystery file (WikiLeak Blackmails US and Blames US for Dead Informants)
New Europe ^ | July 31, 2010 | Andy Carling

Posted on 08/01/2010 2:55:37 AM PDT by tlb

Julian Assange has uploaded a file called “insurance” to the website and elsewhere. The file is 1.4 gigabytes, a thousand times larger than the recently leaked documents.

It is estimated that even the fastest computer would take millions of years to decrypt the file.

It is believed that Assange may have distributed the pass key to supporters, who could release it to the public.

The contents of the file are unknown. However, the recent release of documents, detailing the coalition’s experiences in Afghanistan, are not part of the 500,000 documents from Iraq, alleged to have been sent to WikLeaks by Bradley Manning.

Admiral. Mike Mullen, chairman of the Joint Chiefs of Staff, said that Assange and WikiLeaks may “already have on their hands the blood of some young soldier or that of an Afghan family.”

An angry Assange responded by asking “Why is the Pentagon focusing on the hypothetical blood on our hands, which has never been proved, rather than the real blood of the 20,000 deaths revealed in the documents?”

The top whistle blower, also criticized the US for “sloppy” and “unprofessional” security. WikiLeaks only uses code names internally for sources. Assange criticised the accessibility of the documents, saying, the information, including names of informants, “was available to every member of the U.S. military and every U.S. contractor — not just in Afghanistan — but all over the world. The military has acted in a disgraceful and careless way.”

Assange told reporters that he has plenty more material to be published, including “very significant” information on the BP oil spill and abuses in the US military, including sexual abuse.

In the meantime, the mystery file is being downloaded by many people, waiting for the key.

(Excerpt) Read more at neurope.eu ...


TOPICS: Crime/Corruption; Extended News; Government; Politics/Elections
KEYWORDS: assange; blackmail; files; insurance; julianassange; wikileaks
Navigation: use the links below to view more comments.
first 1-2021-4041-54 next last
Tried to post the Wired story but that site is blocked as a source.

Possible bluff, but it's not like anybody in this administration will call him on it. Further even without the "insurance" I saw nothing to make me think anybody would move against him regardless.

Apparently though he has been stung by those who say he is getting Afghani informants killed.

1 posted on 08/01/2010 2:55:42 AM PDT by tlb
[ Post Reply | Private Reply | View Replies]

To: tlb; SunkenCiv
1.4 gigabytes encrypted by AES256, this must be a magnet for all Sigint organizations in the whole world.

How could a 22-year old get TS clearance??? and why was the data that he processed not compartmentalized?

2 posted on 08/01/2010 3:34:25 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 1 | View Replies]

To: AdmSmith

Meanwhile, the Taliban appears to be carefully combing the documents that have been leaked. “We will investigate through our own secret service whether the people mentioned [in the Wikileaks documents] are really spies working for the U.S.,” Taliban spokesman Zabihullah Mujahid told Britain’s Channel 4 News. “If they are U.S. spies, then we know how to punish them.”

http://www.pcworld.com/article/202309/mystery_file_posted_to_wikileaks_afghan_page.html


3 posted on 08/01/2010 3:35:49 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 2 | View Replies]

To: tlb

The man is either a stupid fool or writer has it wrong. No encryption software exists today that the government can’t break in a few days with their massively parallel arrayed decryption computers.


4 posted on 08/01/2010 3:41:40 AM PDT by BushCountry (I spoken many wise words in jest, but no comparison to the number of stupid words spoken in earnest)
[ Post Reply | Private Reply | To 1 | View Replies]

To: AdmSmith

Any service person can get a TS clearance, but they do not receive any more classified info for which they have a “need to know” to do their job. Everythign is segmented and compartmentalized. He may have been hacking and stealing info.


5 posted on 08/01/2010 3:42:09 AM PDT by shalom aleichem
[ Post Reply | Private Reply | To 2 | View Replies]

To: tlb

I wish Wikileaks would do something patriotic FOR the USA, expose Obamas past, his history, all his credential, the entire enchilada, from the Dunham side of the family selling B-29 plans to the Russians to the connections of the American Communist party and rumored financial backing from Castro and his 50 years dream of ultimate revenge upon America.


6 posted on 08/01/2010 3:43:01 AM PDT by Eye of Unk ("In a time of universal deceit, telling the truth becomes a revolutionary act" G.Orwell)
[ Post Reply | Private Reply | To 1 | View Replies]

To: tlb

this guy needs to get acquainted with the business end of a Mossad hushpuppy


7 posted on 08/01/2010 3:43:48 AM PDT by LeoWindhorse
[ Post Reply | Private Reply | To 1 | View Replies]

To: AdmSmith

Why did it take the military four years to get MSRAP vehicles that have been around for fifty years? Why launch Challenger against your engineers in freezing weather? Why spend trillions on urban renewal, HUD, Fresh Start when for decades it has been shown not to work but make things worse?

Why have one CIA Director surfing Russian porn sites with his issued laptop and another NS Director smuggling out documents in his pants?

We’re talking government. You think anyone is going to fall for having a gay, battalion intel clerk get this stuff?


8 posted on 08/01/2010 3:45:53 AM PDT by Leisler ("Over time they create a legal system that plunders and a moral code that glorifies it." F. Bastiat)
[ Post Reply | Private Reply | To 2 | View Replies]

To: tlb; All

I’d love to hear from any legal experts on the forum if this guy can hypothetically be tried for treason and sentenced to the death penalty if found guilty. Although not likely to happen with this administration, I’d still like to know if it’s possible.

For the sake of national security though, it would be good if he disappeared.


9 posted on 08/01/2010 3:51:49 AM PDT by Rammer
[ Post Reply | Private Reply | To 1 | View Replies]

To: Leisler

there may have already been soemone who fell for that gay intel clerk...and that’s how the gay intel clerk got his information.


10 posted on 08/01/2010 4:15:04 AM PDT by RaceBannon (RON PAUL: THE PARTY OF TRUTHERS, TRAITORS AND UFO CHASERS!!!)
[ Post Reply | Private Reply | To 8 | View Replies]

To: BushCountry

If 1.4 gb is 1000 times larger than the previous release, that’d mean that the previous release was only 1.4 MB... small enough to fit on an old-fashioned (1980s) floppy drive.


11 posted on 08/01/2010 4:20:00 AM PDT by dangus
[ Post Reply | Private Reply | To 4 | View Replies]

To: Rammer
I’d love to hear from any legal experts on the forum if this guy can hypothetically be tried for treason and sentenced to the death penalty if found guilty. Although not likely to happen with this administration, I’d still like to know if it’s possible.

I am not any kind of expert.

But I recall about ten years ago, when I had to reactivate a clearance, I asked the FBI interviewer what the status of the Designated Counties List was, and he said with disgust, "It's not politically correct any more".

That said, regardless that I doubt anything will be done, the people responsible and the people in the press who republished it need to be whacked. Today.

12 posted on 08/01/2010 4:20:10 AM PDT by Gorzaloon (CNN:AP:etc:Today, President Obama's stool was firm and well-formed. One end was slightly pointed. ")
[ Post Reply | Private Reply | To 9 | View Replies]

To: AdmSmith

If they needed it for his job; and all communications types need high level security clearances, they would have a background investigation and if passed, given the appropriiate clearance. I’d have to guess there may have been some in that age group on the USS Pueblo. The reserve unit I joined in the late ‘60s was a group of cryptologists. I had a TS by 20 y/o.


13 posted on 08/01/2010 4:23:07 AM PDT by Tucson (Sometimes we feel guilty because we are guilty)
[ Post Reply | Private Reply | To 2 | View Replies]

To: AdmSmith
Reported on Fox & FRiends this morning that they now believe a civilian installed encrypting devise to help him get documents.
14 posted on 08/01/2010 4:29:12 AM PDT by mware (F-R-E-E, that spells free, Free Republic.com baby.)
[ Post Reply | Private Reply | To 2 | View Replies]

To: Tucson

Same here in the early 70’s. US Army 31S


15 posted on 08/01/2010 4:37:50 AM PDT by mazda77 (Rubio for US Senate - West FL22nd - JD Hayworth - US Senate)
[ Post Reply | Private Reply | To 13 | View Replies]

To: Gorzaloon
"That said, regardless that I doubt anything will be done, the people responsible and the people in the press who republished it need to be whacked. Today."

Oh, they will. They most certainly will. These poor kids cannot fully appreciate what they've unleashed. Young Mr. Assange's infantile attempts at deflection will not save him. It may take years, but eventually somebody's surviving son or daughter will step from the mists of time, and avenge their parent's bloody betrayal. Welcome to the Dark side, Mr. Assange. You tried hard enough to get there. "Vengeance is a dish best served cold, and savored with time."
16 posted on 08/01/2010 4:42:47 AM PDT by PowderMonkey (Will work for ammo)
[ Post Reply | Private Reply | To 12 | View Replies]

To: Tucson

The reserve unit I joined in the late ‘60s was a group of cryptologists. I had a TS by 20 y/o.
= = = = = = = = = = = = = = = = = = = = = =
I went to CT”R” SCO 1957 and had full BI while in Boot Camp (17yo) and received INT TS around 19 (if not earlier, not sure what was reqd for CT SCO) while aboard ship as RM and working as Cryptographer and around TS material...as they said, though most was need to know or ‘eyes only’.


17 posted on 08/01/2010 4:58:44 AM PDT by xrmusn ((6/98 ) FIRE ALL INCUMBENTS)
[ Post Reply | Private Reply | To 13 | View Replies]

To: tlb

Assange is not just ni fear of US government. The Aussie military intelligence hierarchy have been hounding him weeks before he first announced the preannouncement of the big leak.

Fair to say the military intelligence in the Anglosphere and Commonwealth all have him on their radar.


18 posted on 08/01/2010 4:59:19 AM PDT by JerseyHighlander
[ Post Reply | Private Reply | To 1 | View Replies]

To: RaceBannon

Can’t remember. Gays from elite British schools, ‘meeting’ American elite gays, all passing on to the Soviets.


19 posted on 08/01/2010 5:06:02 AM PDT by Leisler ("Over time they create a legal system that plunders and a moral code that glorifies it." F. Bastiat)
[ Post Reply | Private Reply | To 10 | View Replies]

To: Leisler

Philby. Never turn your back on a man who calls himself “Kim.” Nyuk...nyuk...nyuk.


20 posted on 08/01/2010 5:11:01 AM PDT by PowderMonkey (Will work for ammo)
[ Post Reply | Private Reply | To 19 | View Replies]


Navigation: use the links below to view more comments.
first 1-2021-4041-54 next last

Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.

Free Republic
Browse · Search
News/Activism
Topics · Post Article

FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson