Free Republic
Browse · Search
General/Chat
Topics · Post Article

--> YouTube-Generated Transcript <--
0:02·what was it that turned hunter gatherers
0:05·into Empire
0:06·[Music]
0:09·Builders I'm traveling through the a
0:12·inspiring landscape of Guin in South
0:15·China in search of the key to their
0:17·success
0:20·[Music]
0:28·[Applause]
0:37·this is the dungen cave excavations here
0:41·tell us it was once lived in by hunter
0:45·gatherers and in 2001 a wonderful
0:49·Discovery was
0:51·[Music]
0:58·made these fragments are so precious
1:01·that I'm not even allowed to touch them
1:04·they are what remains of one of the
1:06·oldest pots in China in fact one of the
1:10·oldest pots in the
1:12·[Music]
1:21·world so who made this pot well the
1:25·people living in this cave so many
1:27·thousands of years ago would have been
1:29·nomadic hunter gatherers still living an
1:32·ancient lifestyle in many ways but those
1:35·insignificant looking crude pieces of
1:38·pot Mark a great technological Leap
1:43·Forward say prehistoric pot has also
1:45·been found in this cave pots are
1:47·something we take for granted but for
1:50·those ancient hunter gatherers Pottery
1:53·was part of a completely new way of
1:58·life so how does they do
2:04·it I'm meeting a team of experimental
2:07·archaeologists who think they might have
2:09·the
2:10·answer the first breakthrough must have
2:13·been finding out how to stop the pots
2:15·cracking when they were fired tempering
2:17·them by mixing calite rock with the clay
2:20·and they even have an idea how the pots
2:22·might have been shaped thousands of
2:24·years before the invention of the
2:26·potter's
2:28·wheel this is very clever they've dug a
2:30·pit here to basically give us the form
2:32·of the pot almost like a mold and then
2:34·we're pressing this clay in little slabs
2:37·down into the preformed
2:41·pit transforming clay into hard Pottery
2:44·requires firing at a high temperature
2:47·today this is done at 1,000° C in a kiln
2:51·Way Beyond the capabilities of those
2:52·hunter gatherers
3:00·they would have had open fires which
3:02·only produce temperatures of about
3:05·250° I'm quite doubtful this is going to
3:08·be
3:13·enough so how's our
3:17·pot I think that's it I think that's I
3:19·think that's our pot there and it looks
3:25·[Music]
3:28·okay fantastic
3:33·ftic there are many different theories
3:35·about why the Chinese hunter gatherers
3:37·might have started making pots some
3:38·people say it was a symbol of prestige
3:41·but the Chinese archaeologists think
3:43·that the explanation is much more simple
3:48·cooking pots meant that a wider range of
3:50·food could be cooked and stored vital in
3:55·hard times and by 9,000 years ago there
3:59·was another
4:00·Innovation
4:02·farming one of the things that those
4:05·early Chinese poses would have been
4:06·eating was wild rice now it certainly
4:09·wouldn't have been the main source of
4:11·food because it was hard to collect and
4:13·actually didn't give much energy in
4:14·return but despite the availability of
4:17·other vegetables it was rice that became
4:20·more and more important and even crucial
4:23·to the early success of the
4:28·Chinese for

1 posted on 11/15/2024 2:37:45 PM PST by SunkenCiv
[ Post Reply | Private Reply | View Replies ]


To: SunkenCiv

beer...


2 posted on 11/15/2024 2:41:25 PM PST by Chode (there is no fall back position, there's no rally point, there is no LZ... we're on our own. #FJB)
[ Post Reply | Private Reply | To 1 | View Replies ]

To: SunkenCiv

Winter.


7 posted on 11/15/2024 2:48:43 PM PST by Openurmind
[ Post Reply | Private Reply | To 1 | View Replies ]

To: SunkenCiv

We needed a place to stash all the stuff we’d gathered. :)


13 posted on 11/15/2024 3:08:45 PM PST by Diana in Wisconsin (I don't have, 'Hobbies.' I'm developing a robust Post-Apocalyptic skill set.)
[ Post Reply | Private Reply | To 1 | View Replies ]

To: SunkenCiv

McDonalds...thexsearch for Big Macs drove empires...


15 posted on 11/15/2024 3:31:40 PM PST by Adder (End fascism...defeat all Democrats.)
[ Post Reply | Private Reply | To 1 | View Replies ]

To: SunkenCiv

later


18 posted on 11/15/2024 4:04:12 PM PST by Gay State Conservative (Import The Third World,Become The Third World)
[ Post Reply | Private Reply | To 1 | View Replies ]

To: SunkenCiv

“What Turned Hunter-Gatherers Into Empire Builders?”

I know the answer to that:

The ( hunters/men ) did not hunt enough money for the ( gatherers/women. )

The men had to find other means to support the gatherers! ;-)

See how easy that was to solve? ;-)


19 posted on 11/15/2024 4:23:39 PM PST by spel_grammer_an_punct_polise (Learn three chords and you, too, can be a Rock Star!)
[ Post Reply | Private Reply | To 1 | View Replies ]

To: SunkenCiv

Mark for later viewing.


20 posted on 11/15/2024 5:52:31 PM PST by Honorary Serb (Kosovo is Serbia! Free Srpska! Abolish ICTY!)
[ Post Reply | Private Reply | To 1 | View Replies ]

To: SunkenCiv

Agriculture.


22 posted on 11/15/2024 6:51:01 PM PST by Mr. Blond
[ Post Reply | Private Reply | To 1 | View Replies ]

To: SunkenCiv

farming + mining


26 posted on 11/16/2024 4:02:43 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 1 | View Replies ]

To: SunkenCiv

Hunter gatherers, farmers? Nah. Empire? $$$ = attract more women.


31 posted on 11/16/2024 6:59:14 PM PST by central_va (I won't be reconstructed and I do not give a damn...)
[ Post Reply | Private Reply | To 1 | View Replies ]

Free Republic
Browse · Search
General/Chat
Topics · Post Article


FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson