Free Republic
Browse · Search
General/Chat
Topics · Post Article

Skip to comments.

ONCOLOGIST: mRNA ‘vaccines’ must be banned once and for all
Conservative Woman ^ | Sep 29 | Angus Dalgleish

Posted on 10/11/2023 8:36:38 PM PDT by RandFan

click here to read article


Navigation: use the links below to view more comments.
first previous 1-2021-4041-6061-8081 next last
To: RandFan
Very sobering. How much longer before people suddenly wake up to what they’ve done to themselves?
41 posted on 10/12/2023 6:55:15 AM PDT by GBA (Endeavor to persevere)
[ Post Reply | Private Reply | To 1 | View Replies]

To: grey_whiskers; ransomnote

So are you on the staff of either of those two Brit conspiracy nut sites?

TWC “The Conservative Woman” looks like it’s trying to be an upscale version of the more openly nutty Daily Expose. Same conspiracy fear porn just less obvious. I bet there could even be a connection between both and FR.


42 posted on 10/12/2023 6:56:54 AM PDT by Pelham (President Eisenhower. Operation Wetback 1953-54)
[ Post Reply | Private Reply | To 27 | View Replies]

To: RandFan

Yet we get nothing from our government as to the risks.


43 posted on 10/12/2023 6:58:40 AM PDT by 1Old Pro
[ Post Reply | Private Reply | To 1 | View Replies]

To: Pelham

Troll harder, nobody is listening to you.

Go tell Pfauci you’re striking out again.


44 posted on 10/12/2023 7:07:16 AM PDT by grey_whiskers ( The opinions are solely those of the author and are subject to change without notice.)
[ Post Reply | Private Reply | To 42 | View Replies]

To: libh8er

Nope, you’re the troll.


45 posted on 10/12/2023 7:08:45 AM PDT by grey_whiskers ( The opinions are solely those of the author and are subject to change without notice.)
[ Post Reply | Private Reply | To 36 | View Replies]

To: Veto!

It was not mRNA vax.


46 posted on 10/12/2023 7:09:59 AM PDT by Chickensoup (Genocide is here. Leftist extremists are spearheading the Genocide against conservatives. )
[ Post Reply | Private Reply | To 26 | View Replies]

To: libh8er

For some reason Britain has always been a hotbed of vaccine nuts, it began long before Covid.

The whole MMR autism scare got started in Britain with Andrew Wakefield and some American actress.

That was back in 1998 when Wakefield published an article in Lancet.

Unfortunately for Wakefield other doctors checked his research and discovered that he had falsified it which ultimately cost him his job.

That’s a risk of submitting to a peer reviewed journal. Research can get peer reviewed and fraud can get exposed. The conspiracy crowd avoids peer reviewed journals, their citations take you to their own sites where they are safe.


47 posted on 10/12/2023 7:22:13 AM PDT by Pelham (President Eisenhower. Operation Wetback 1953-54)
[ Post Reply | Private Reply | To 30 | View Replies]

To: Pelham

“ The conspiracy crowd avoids peer reviewed journals, their citations take you to their own sites where they are safe.”

Exactly. The cultists are only looking for confirmation, not scientific explanation. Any doctor who for whatever reason affirms their belief (only a small handful of names keep popping up on conspiracy sites) becomes a ‘highly respected doctor’ whereas others(the vast majority) are pharma shills, deep staters and whatever else.


48 posted on 10/12/2023 7:41:49 AM PDT by libh8er
[ Post Reply | Private Reply | To 47 | View Replies]

To: libh8er

Your gaslighting will not work.

Troll.


49 posted on 10/12/2023 8:02:31 AM PDT by grey_whiskers ( The opinions are solely those of the author and are subject to change without notice.)
[ Post Reply | Private Reply | To 48 | View Replies]

To: GBA
How much longer before people suddenly wake up to what they’ve done to themselves?

I've taken someone else to the ER for TERRIBLE PAIN TO THE HEART after their booster (3rd shot)

The person after 2nd shot went to the ER for intestinal pain where they gave morphine to address the pain

The person had to get a hearing aid due to loosing hearing (you don't have to look hard to see that the vaxxxxxxxxines cause hearing problems too)

Now, the person can't wait to get their flu shot even though they have seen that the mRNA is added there too...

And one of her friends died in his sleep with "brain bleed." YES, it could have been old age BUT ...

She will keep taking jabs of some kind until they kill her. She is one of MILLIONS who will die by the jab as long as they allow the idiots with medical degrees to keep pushing the poison.

50 posted on 10/12/2023 8:06:26 AM PDT by politicianslie (SAFE and EFFECTIVE has become SUDDEN and UNEXPECTED. Use Dr. McCullough protocol to beat death! )
[ Post Reply | Private Reply | To 41 | View Replies]

To: GBA
How much longer before people suddenly wake up to what they’ve done to themselves?

I've taken someone else to the ER for TERRIBLE PAIN TO THE HEART after their booster (3rd shot)

The person after 2nd shot went to the ER for intestinal pain where they gave morphine to address the pain

The person had to get a hearing aid due to loosing hearing (you don't have to look hard to see that the vaxxxxxxxxines cause hearing problems too)

Now, the person can't wait to get their flu shot even though they have seen that the mRNA is added there too...

And one of her friends died in his sleep with "brain bleed." YES, it could have been old age BUT ...

She will keep taking jabs of some kind until they kill her. She is one of MILLIONS who will die by the jab as long as they allow the idiots with medical degrees to keep pushing the poison.

51 posted on 10/12/2023 8:06:27 AM PDT by politicianslie (SAFE and EFFECTIVE has become SUDDEN and UNEXPECTED. Use Dr. McCullough protocol to beat death! )
[ Post Reply | Private Reply | To 41 | View Replies]

To: politicianslie

What a sad and frustrating situation. Best wishes and God’s blessings for healing and a change of head and heart!


52 posted on 10/12/2023 8:48:50 AM PDT by GBA (Endeavor to persevere)
[ Post Reply | Private Reply | To 51 | View Replies]

To: Veto!
He got Novavax,

Novavax is NOT mRNA; it is a measured, finite amount of spike protein.

Novavax requires two injections spaced 10 days (?) apart.

It's probably worthless, but it's fundamentally different from the experimental synthetic mRNA injections produced through Donald Trump's "Operation Warp Speed".

53 posted on 10/12/2023 8:58:25 AM PDT by NorthMountain (... the right of the peopIe to keep and bear arms shall not be infringed)
[ Post Reply | Private Reply | To 26 | View Replies]

To: libh8er
You will sooner change the minds of Gaza militants on Israel than the anti vax hysterics on the vaccine.

It's highly entertaining though. There's no way a write of fiction could cook up the hare-brained hallucinations that the Q-anon folks serve up on the regular. You kind of have to admire their creativity and persistence.

54 posted on 10/12/2023 10:39:23 AM PDT by absalom01 (You should do your duty in all things. You cannot do more, and you should never wish to do less.)
[ Post Reply | Private Reply | To 30 | View Replies]

To: RandFan

And now they have their sights set on Africa....see below...

Gates Foundation invests $40M in African mRNA vaccine access
The Bill & Melinda Gates Foundation is investing $40 million to boost access to mRNA vaccines in Africa, with $20 million going to Quantoom Biosciences and $5 million each to the Institut Pasteur de Dakar and Biovac, as well as $10 million for other vaccine manufacturers. Efforts are being made to provide fair access to mRNA vaccines, and platforms like Quantoom’s Ntensify are helping to make vaccine production more affordable.
Full Story: Reuters (10/9)


55 posted on 10/12/2023 10:49:52 AM PDT by bamafour
[ Post Reply | Private Reply | To 1 | View Replies]

To: exDemMom
said, "The sequence of SARS-CoV2 is in the public domain and anyone can check it. I checked it personally. Unnatural sequences simply are not there."

you didn't see this?
Here is the BLAST report:
https://www.ncbi.nlm.nih.gov/nuccore/NC_045512.2

What is this:
Plasmodium yoelii strain 17X genome assembly
Yoelii « Fam a » on 63 bases:
CACAAATCAAAAATTTAGTCAAAATAAAACCAATTATATATTTTGATCATATTAATTTTTCAA
HIS LYS SER LYS ILE ARR SER LYS ARR ASN GLN LEU TYR ILE LEU ILE ILE LEU ILE PHE GLN
The homologous region on yoelii "Fam a", produces
CAC AAA TCA AAC AAA TTT ACA AAA CAC AAA CCA AAA AAA AAT
56 posted on 10/15/2023 2:56:11 AM PDT by Steve Van Doorn
[ Post Reply | Private Reply | To 24 | View Replies]

To: Getready; exDemMom
"SV40 promoters are NOT oncogenic." - said, Dr. exDemMom, infectious disease and vaccines research specialist

No one said it was. SV40 is believed to be a suppressor of the p53 gene which is our natural immunity of cancer.

exDemMom knows the difference given she is a research specialist.
The question is why did she worded it that way?

I put you down a year ago exDemMom as a possible bad actor on Freerepublic. This is more evidence of that.
57 posted on 10/15/2023 12:05:28 PM PDT by Steve Van Doorn
[ Post Reply | Private Reply | To 32 | View Replies]

To: Steve Van Doorn; exDemMom

Where did you find “Plasmodium yoelii” mentioned in the paper at the link?

I scanned it several times and I don’t see any mention of Plasmodium yoelii anywhere in the paper.

Did you actually find “Plasmodium yoelii” mentioned in the report yourself? Or are you just inventing that or repeating what someone told you?

Here’s the link again for anyone that’s curious; there’s very little descriptive commentary:

https://www.ncbi.nlm.nih.gov/nuccore/NC_045512.2

Severe acute respiratory syndrome coronavirus 2 isolate Wuhan-Hu-1, complete genome


58 posted on 10/16/2023 1:15:08 AM PDT by Pelham (President Eisenhower. Operation Wetback 1953-54)
[ Post Reply | Private Reply | To 56 | View Replies]

To: Pelham

The poster Steven Van Doorn has previously made reference to a May 2020 posting co signed by Luc Montagnier that claimed to have found exogenous RNA sequences. It’s here:

https://www.researchgate.net/publication/341768159_Jean_claude_Perez_Luc_Montagnier_-_COVID-19_SARS_and_Bats_Coronaviruses_Genomes_Unexpected_Exogenous_RNA_Sequences

There may be other, even more delirious sources, but this appears to be the original genesis of this particular notion.


59 posted on 10/16/2023 8:32:50 AM PDT by absalom01 (You should do your duty in all things. You cannot do more, and you should never wish to do less.)
[ Post Reply | Private Reply | To 58 | View Replies]

To: Pelham
What you do is compare the two. The yoelii fragments easier to see in the covid-19 protein ORF3a
here is Plasmodium yoelii
https://www.ncbi.nlm.nih.gov/nucleotide/XM_022956016.1?report=genbank&log$=nuclalign&blast_rank=4&RID=CPZ4YRXE01R

First you take the homologous region on yoelii "Fam a", HKSNKFTKH KP K the translation produces
CAC AAA TCA AAC AAA TTT ACA AAA CAC AAA CCA AAA AAA AAT ...
Then we find a nearly perfect homology of amino acids. AAG / AAA and AAG / AAA

Which you can find in the ORF3a protein here:
https://www.ncbi.nlm.nih.gov/nuccore/MT345837.1?report=fasta

That's not all. Plasmodium yoelii was found in SIV, SARS, RATG13 and Covid. Which COVID-19 has the most with 36/42 bases 10/14 amino acids

It's freaking nuts what they're doing.
60 posted on 10/16/2023 11:47:34 AM PDT by Steve Van Doorn
[ Post Reply | Private Reply | To 58 | View Replies]


Navigation: use the links below to view more comments.
first previous 1-2021-4041-6061-8081 next last

Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.

Free Republic
Browse · Search
General/Chat
Topics · Post Article

FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson