Free Republic
Browse · Search
General/Chat
Topics · Post Article

Skip to comments.

Update from Ukraine | The Ruzzian Defense in Boiling | Ukraine entered the trenches. South Frontline
Youtube.com ^ | 10-3-2023 | Denys Davydov

Posted on 10/03/2023 8:31:30 PM PDT by UMCRevMom@aol.com

Update from Ukraine | The Ruzzian Defense in Boiling | Ukraine entered the trenches. South Frontline https://www.youtube.com/watch?v=B1wAuSWL2-Q

Posted on 10/2/2023, 10:11:34 PM by UMCRevMom@aol.com

Update from Ukraine | Ukraine Advances on the South | Does USA stop the Military Support? https://www.youtube.com/watch?v=x4U0nr-vzi0

The summary of the situation of Russian re-invasion to Ukraine covering the recent developments on the battlefield, as of 30th September 2023 – 22:00 (Kyiv time). [NOTE: two summaries per week, released on Wednesday and Sunday]

https://militaryland.net/news/invasion-day-584-summary/

*** Great interactive maps with viewer controlled Map magnification tool to use for each Front!

https://militaryland.net/maps/


TOPICS:
KEYWORDS: denysdoesdonbas; lol; reportforf16dutyden; swisscheezzy; updatefromluzern; war; youtubebloodmoney; zot
Navigation: use the links below to view more comments.
first previous 1-2021-4041-6061-73 next last
To: Allegra
Dancing with Denys!!


41 posted on 10/03/2023 11:04:42 PM PDT by kiryandil (China Joe and Paycheck Hunter - the Chink in America's defenses)
[ Post Reply | Private Reply | To 34 | View Replies]

To: AdmSmith; AmericanInTokyo; Apparatchik; AZJeep; BabaOreally; babble-on; BeauBo; bert; blitz128; ...

ARTICLE - VIDEO SUMMATION COMMENTARY

03 Oct: Ukrainians DESTROY 14 TANKS AND ARMORED FIGHTING VEHICLES around Novoprokopivka
Reporting from Ukraine
411K subscribers
10-2-2023 12:05 a.m. EDT
https://www.youtube.com/watch?v=IOB-Wnck7r8

⚠️ Watch RFU in 20 languages: https://www.youtube.com/@RFU/channels

I am Ukrainian. My country has been invaded by Russia. In this video I will tell you what happened on the five hundred eighty seventh day of the war.

Day 587: Oct 03

Today, there are a lot of interesting developments in the Tokmak direction.

Here, the toughest fights took place in and around Novoprokopivka. After Ukrainians conducted a series of attacks in the direction of the village, Russian forces understood that they could not hold defense tightly in the houses and decided to make a counterattack to regain control over the trenches in front of the village.

Recently released footage by the Ukrainian side shows how a small Russian assault unit tried to attack the entrances in the tree lines. The Russians managed to close the distance and jump into the dugouts and other fortifications, complicating the job of the Ukrainian artillery. The footage also shows how a lot of shells explode in the tree line, however, the aftermath of the engagement was unclear.

Moreover, Russian sources published a video that shows Russian forces striking a Ukrainian vehicle just south of the middle of the three trenches. Based on the available information, the Institute for the Study of War concluded that Ukrainians likely lost control over this part of the trench network, and the Russian counterattack was successful.

However, as it turned out, the Russian counterattack was actually rebuffed. Today, Russian forces published a video showing how Ukrainian forces are walking in the tree line. Once the Russian artillery opened fire, Ukrainian soldiers jumped precisely into the entrances of the trench network that Russians had tried to assault a few days prior, confirming that the whole defense line was under total Ukrainian control.

Moreover, some analysts also noted that judging by the direction of the movement, the Ukrainian soldiers were actually returning from an assault or reconnaissance operation in Novoprokopivka, so the attacks on the village continued. Based on that footage, the Institute for the Study of War also reevaluated the situation and concluded that Ukrainian forces retook these positions and currently hold them.

And the situation for Russians is steadily deteriorating. Recently released footage shows yet another Ukrainian night assault on Novoprokopivka. Given the area of operation of the Ukrainian forces, the whole northern part of the village is now considered a grey zone.

And as you remember, the northern part of the village is located on the tactical heights, so if Ukrainians consolidate control over the empty ground, Russians will lose grip on the village, especially given that the Russian 1152 regiment that is responsible for the region is reportedly on the verge of losing its combat capability.

Over the last few days, Ukrainians have inflicted substantial losses on the Russian forces not only in terms of manpower, but also heavy equipment. Ukrainian Special Forces published a video that shows how they extracted information via an intercepted call about a big group of Russian forces that was meant to reinforce Novoprokopivka, sent reconnaissance drones south of Novoprokopivka for identification of targets, and detected 5 armored fighting vehicles, 2 trucks and a field ammunition depot in a tree line. In coordination with HIMARS crews, all targets were promptly destroyed.

Another Russian column with reinforcements was detected west of Novoprokopivka. Ukrainian fighters from the Immaterium detachment identified 5 armored fighting vehicles, which were also destroyed by artillery.

Another Ukrainian detachment identified a group of 4 Russian tanks east of Novoprokopivka. All 4 tanks were destroyed. A Ukrainian ATGM crew also published a video of how they destroyed a Russian short-range air defense system just behind Novoprokopivka.

Finally, Russian forces also destroyed one air defense system themselves – as reported by Russian sources, the driver lost control of the vehicle, and they got hit by a train. As a result, Russians lost an air defense system, its crew, and also damaged the train that got derailed. The lack of heavy equipment in the Russian detachments that are defending Novoprokopivka is very good news for the Ukrainian assault units in this direction.

*** Select the 3 horizontal dots to view the Complete Transcript [Below video/ top right corner]


42 posted on 10/03/2023 11:07:26 PM PDT by UMCRevMom@aol.com (Pray for God's intervention to stop Putin's invasion of Ukraine )
[ Post Reply | Private Reply | To 40 | View Replies]

To: UMCRevMom@aol.com

Is spelling Russia with “z” supposed to be cute or some insider signal?


43 posted on 10/03/2023 11:10:52 PM PDT by doorgunner69 (When tyranny becomes law, rebellion becomes duty)
[ Post Reply | Private Reply | To 1 | View Replies]

To: All

Estonia can join the rehabilitation of the Ukrainian economy, war risk insurance and humanitarian demining, says Yuliia Svyrydenko
Ministry of Economy of Ukraine,
03 October 2023 11:34
https://www.kmu.gov.ua/en/news/estoniia-mozhe-doluchytys-do-vidnovlennia-ukrainskoi-ekonomiky-strakhuvannia-voiennykh-ryzykiv-ta-do-humanitarnoho-rozminuvannia-iuliia-svyrydenko

Estonia is considering the possibility of implementing new projects to restore the destroyed infrastructure and is also looking for opportunities to expand economic cooperation with Ukraine. This was discussed during a meeting of the First Deputy Prime Minister of Ukraine, Minister of Economy of Ukraine Yuliia Svyrydenko with a delegation headed by the Minister of Foreign Affairs of Estonia Margus Tsahkna.

“First of all, I would like to express my sincere gratitude for the outstanding level of support for Ukraine in providing military, financial and humanitarian aid. Thanks to the assistance of our partners, especially such good friends as Estonia, Ukraine demonstrates that it can maintain stability even in the face of total aggression.

Now the issues of economic recovery are of utmost importance to us. And we invite Estonian businesses to invest in Ukraine, including in logistics, energy, processing, and IT. To implement these plans, we need to introduce effective instruments of war risk insurance. And if Estonia, through its export credit agency KredEx, insures not only Estonian but also Ukrainian investments, we will thereby encourage the creation of many joint Ukrainian-Estonian enterprises. We don’t know how long the war will last, so we need to learn to fight, work and live all at once,” stressed Svyrydenko.

According to her, a special priority for the Ministry of Economy is now the humanitarian demining of Ukrainian lands. Currently, 174,000 square kilometers of Ukraine’s territory are potentially contaminated with explosives, including the temporarily occupied territories.

“Ukraine is now a large field for testing both military equipment and demining machines. And these areas are developing very quickly. For example, last year we did not have a single manufacturer of heavy demining machines. So we imported them from Croatia and Slovakia. And today we are already producing such machines in Ukraine. We are now trying to develop drones with a scanner that will help us identify plastic mines. If Estonian business is ready to join development of such solutions, we invite it to Ukraine,” assured Yuliia Svyrydenko.

The parties also discussed the possibility of involving Estonia in co-financing direct support programs for small and medium-sized businesses and a number of social projects.

BACKGROUND INFORMATION
- Estonia began providing military assistance to our country before the start of russia’s large-scale war against Ukraine, which influenced the combat operations in the first weeks of the war. The Estonian government has contributed more than EUR 400 million in military aid, which is more than 1% of Estonia’s GDP. As of today, Estonia has already provided 16 military aid packages to Ukraine.

- Since the beginning of the russian aggression against Ukraine, Estonia has already provided humanitarian aid to Ukraine in the amount of EUR 24.6 million, of which governmental aid is EUR 5.6 million and private aid is EUR 19.0 million.

- The Estonian side is rendering assistance in the post-war reconstruction of Zhytomyr region and focuses on two areas: repair and construction of public buildings and rehabilitation of affected women and children (in 2022, EUR 1.98 million were allocated for recovery purposes).


44 posted on 10/03/2023 11:12:39 PM PDT by UMCRevMom@aol.com (Pray for God's intervention to stop Putin's invasion of Ukraine )
[ Post Reply | Private Reply | To 42 | View Replies]

To: UMCRevMom@aol.com

ARTICLE

Prime Minister: We are launching two more pilot projects for veterans and military personnel
Communications Department of the Secretariat of the CMU,
03 October 2023 14:21
https://www.kmu.gov.ua/en/news/premier-ministr-zapuskaiemo-shche-dva-eksperymentalni-proekty-dlia-veteraniv-i-viiskovykh

The Government triggers two more pilot projects for veterans and military personnel. Prime Minister Denys Shmyhal announced during a Government session on
October 3.

“The first one is the provision of a new comprehensive social service - resilience building. It includes a number of options. In particular, social and psychological assistance, formation and development of social skills and abilities, assistance in adaptation, etc. Every veteran, his or her family or a group of people will be eligible to receive the service,” noted Denys Shmyhal.

The second project is social support for military personnel and their families in military units.

“We are talking about psychosocial support to strengthen families, assistance in paperwork, assistance in communication with state and local authorities,” the Prime Minister noted and added that the projects would be coordinated by the Ministry of Social Policy, which would soon provide all the details of the projects.

The Head of Government emphasized that Ukraine was already radically changing its veteran policy, as it provided extensive economic opportunities for our defenders: business, work, retraining, adaptation, barrier-free access, housing for veterans, establishment of veteran development centers, and introduction of a veteran assistant.

According to the Prime Minister, people are currently being selected and trained to provide peer-to-peer support to veterans. The number of applicants exceeds the number of vacancies.

Government embarks on work on a single Reform Plan until 2027: Prime Minister
Communications Department of the Secretariat of the CMU,
03 October 2023 14:00
https://www.kmu.gov.ua/en/news/uriad-rozpochav-robotu-nad-iedynym-planom-reform-do-2027-roku-premier-ministr

Partner initiatives and other proposals will be combined into a single roadmap for change. This was announced by Prime Minister Denys Shmyhal during a Government meeting on October 3.

“We embark on work on a single Reform Plan until 2027. The plan will cover all areas that affect state institutions, the economy and interaction with citizens,” said Denys Shmyhal.
According to the Prime Minister, Ukraine has a number of documents with reform proposals from our partners - from 7 EU recommendations to the list of IMF structural beacons. At the initiative of President Volodymyr Zelenskyy, the Concept of Strengthening the Stability of Democracy was developed.

“This document was handed over by the President of Ukraine to the U.S. President during his visit to the United States. Now we are starting to work on creating a single document - a roadmap for reforms - based on the Concept of Strengthening the Stability of Democracy, taking into account the proposals of our partners,” the Head of Government noted.

According to the Prime Minister, the Reform Plan will become a part of the future Ukrainian Doctrine, the principles of which were outlined by the Head of State.

“The document should include important goals: the development of state institutions, the development of a competitive economy and the strengthening of interaction between the state, the business environment and civil society,” said Denys Shmyhal.

The Head of Government stressed that reforms will be the foundation of our victory and the key to successful recovery and growth.

THE CONCEPT OF STRENGTHENING THE STABILITY OF DEMOCRACY IN UKRAINE ( .pdf , 134.77 Кб )
https://www.kmu.gov.ua/storage/app/sites/1/18%20-%20Department/18%20-%20PDF/2023/3.10.2023/kontseptposilennyastiikostieng.pdf


45 posted on 10/03/2023 11:14:16 PM PDT by UMCRevMom@aol.com (Pray for God's intervention to stop Putin's invasion of Ukraine )
[ Post Reply | Private Reply | To 44 | View Replies]

To: UMCRevMom@aol.com
Thanks, I have not seen Kanal13 before. It was founded by Aziz Orujov in Azerbaijan. https://az.wikipedia.org/wiki/Kanal13

and he had problems with the authorities earlier https://www.hrw.org/news/2018/04/05/azerbaijan-released-wrongly-jailed-journalist
46 posted on 10/03/2023 11:14:17 PM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 35 | View Replies]

To: UMCRevMom@aol.com

“ The draft state budget for 2024 includes resources to help the agricultural sector: affordable business loans, grant programs, and compensation for the purchase of Ukrainian agricultural machinery. This was stated by Prime Minister Denys Shmyhal during a Government meeting on October 3.”
*******************************************************************

And you can take it to the bank that THIS IS ALL AMERICAN TAXPAYER MONEY!

If only we were giving “affordable business loans, grant programs and compensation for the purchase of agricultural machinery” to AMERICANS FARMERS INSTEAD OF UKRAINIAN FARMERS. But that would be, of course, too damn MAGA for you Neocon/globalists.


47 posted on 10/04/2023 12:22:47 AM PDT by House Atreides (I’m now ULTRA-MAGA. -PRO-MAX)
[ Post Reply | Private Reply | To 39 | View Replies]

To: UMCRevMom@aol.com

The Defeat Of The AFU At Bakhmut, Russian Offensive At Marinka. Military Summary For 2023.10.3

https://www.youtube.com/watch?v=hhogs03NIfI


48 posted on 10/04/2023 12:36:33 AM PDT by House Atreides (I’m now ULTRA-MAGA. -PRO-MAX)
[ Post Reply | Private Reply | To 1 | View Replies]

To: UMCRevMom@aol.com

I understand the desire to get out of the “world police” neocon role and save a buck ‘o five, but it takes quite the leap to be so lost in Biden Derangement Syndrome that the prospect of Putin’s future invasions / nuclear escalation roadmap triggering article 5 doesn’t register as an existential threat.

Imagine watching Team America and thinking so far beyond “the FAGs and the neocons are the baddies” premise that you’re actively rooting for Kim Jong Il and googling the emigration route to move to Pyongyang.


49 posted on 10/04/2023 12:49:59 AM PDT by MalPearce ("You see, but you do not observe" - Holmes to Watson, A Scandal in Bohemia)
[ Post Reply | Private Reply | To 32 | View Replies]

To: UMCRevMom@aol.com

Prayers up!


50 posted on 10/04/2023 4:06:56 AM PDT by popdonnelly (All the enormous crimes in history have been committed by governments.)
[ Post Reply | Private Reply | To 1 | View Replies]

To: AdmSmith
---- "....have not seen Kanal13 before. It was founded by Aziz Orujov in Azerbaijan. https://az.wikipedia.org/wiki/Kanal13 and he had problems with the authorities earlier https://www.hrw.org/news/2018/04/05/azerbaijan-released-wrongly-jailed-journalist"
𝗞𝗔𝗡𝗔𝗟𝟭𝟯 The first professional Internet TV of Azerbaijan - 2008 Первое профессиональное интернет-телевидение в Азербайджане - 2008 Azərbaycanın ilk peşəkar internet televiziyası - 2008 Source:

https://www.youtube.com/@Kanal13AZ/about

The channel "Kanal13" is monetized! Since Nov 6, 2012v, the channel has generated 2,020,765,228 views. Assuming all views were monetized from day 1* with an average RPM of $3.00, this channel has generated $6,062,295.68 over 3915 days. That's an average of $565,194.87 per year.

Additional on the Azerbaijan YouTube content creator:
The first professional Internet TV of Azerbaijan - 2008
Первое профессиональное интернет-телевидение в Азербайджане - 2008
Azərbaycanın ilk peşəkar internet televiziyası - 2008
Managing Staff/İdarə heyəti:
- Founder and Head of Baku Office/Təsisçi və Bakı ofisinin rəhbəri: 𝗔𝘇𝗶𝘇 𝗢𝗿𝘂𝗷𝗼𝘃
- Director/Direktor: 𝗔𝗻𝗮𝗿 𝗢𝗿𝘂𝗷𝗼𝘃
- Editor-in-Chief/Baş redaktor: 𝗘𝗺𝗶𝗻 𝗠𝗮𝗻𝗮𝗳𝗼𝘃

"Kanal13 is one of the official channels of Nar Media Group." Nar is a brand for commercial activities of Azerfon, a mobile telecommunications company, located in Baku, Azerbaijan.

What is most interesting is that this YouTube channel is uploaded in the United States, according to YouTube's About page.

Source: https://www.youtube.com/@Kanal13AZ/about

Additionally, SocialBlade also verifies that the channel is based in the US.

Source: https://socialblade.com/youtube/user/kanal13az

It seems that YouTube content creators' channels are quite the money makers as regards the Ukraine/Russia war, most located / uploaded within the United Sates. Quite a good little cottage industry, which is so often promoted. YouTube takes 45% of the AdSense revenue and passed on the rest.

51 posted on 10/04/2023 5:21:51 AM PDT by Worldtraveler once upon a time (Degrow government)
[ Post Reply | Private Reply | To 2 | View Replies]

To: House Atreides; UMCRevMom@aol.com

Again, I thank you House Atreides for bringing this prayer passage to mind:

PASSAGE 1.
“And when you pray, do not be like the hypocrites, for they love to pray standing in the synagogues and on the street corners to be seen by others. Truly I tell you, they have received their reward in full.

But when you pray, go into your room, close the door and pray to your Father, who is unseen. Then your Father, who sees what is done in secret, will reward you. And when you pray, do not keep on babbling like pagans, for they think they will be heard because of their many words.

Do not be like them, for your Father knows what you need before you ask him. Matthew 6:5-8

Let us continue to join THROUGH OUR PRAYERS for the Ukraine people suffering from this evil invasion of their country by Putin.

PASSAGE 2.
“For we do not want you to be unaware, brothers and sisters, of our affliction which occurred in Asia, that we were burdened excessively, beyond our strength, so that we despaired even of life.

Indeed, we had the sentence of death within ourselves so that we would not trust in ourselves, but in God who raises the dead, who rescued us from so great a danger of death, and will rescue us, He on whom we have set our hope.

And He will yet deliver us, if you also join in HELPING US THROUGH YOUR PRAYERS, so that thanks may be given by many persons in our behalf the favor granted to us through the PRAYERS OF MANY.”
2 Corinthians 1: 8-11


52 posted on 10/04/2023 5:54:52 AM PDT by UMCRevMom@aol.com (Pray for God's intervention to stop Putin's invasion of Ukraine )
[ Post Reply | Private Reply | To 24 | View Replies]

To: AdmSmith

Thank you for your research. Much appreciated!

Apparently, YouTube content creators’ channels are able to benefit from the 1st Constitutional Amendment that prohibits: “the free exercise of religion, or abridge the freedom of speech, the freedom of the press.” Also, these Youtube creators for Ukraine not only present content in support of Ukraine but also are enabled to help Ukraine financially.

“Orujov isy director of Kanal 13, an online station that produces programs on social and economic issues and is often critical of authorities. Police arrested Orujov in May 2017, charged him with resisting authorities, and a court sentenced him to 30 days detention.

Hours before his detention expired, the authorities charged him with illegal entrepreneurship and abuse of authority, claiming that Kanal 13 received funding from abroad and failed to register it with the Ministry of Justice.

The case against Orujov was clearly intended to silence his critical reporting. In December 2017, a Grave Crimes Court convicted Orujov and sentenced him to six years in prison. Amnesty International recognized him as a prisoner of conscience.”


53 posted on 10/04/2023 6:23:30 AM PDT by UMCRevMom@aol.com (Pray for God's intervention to stop Putin's invasion of Ukraine )
[ Post Reply | Private Reply | To 46 | View Replies]

To: popdonnelly

Amen.


54 posted on 10/04/2023 6:24:54 AM PDT by UMCRevMom@aol.com (Pray for God's intervention to stop Putin's invasion of Ukraine )
[ Post Reply | Private Reply | To 50 | View Replies]

To: AdmSmith
On the theme of monetized, United States based YouTube channels, this thread also mentioned the very interesting Combat Veteran Reacts. One learns:
The channel "Combat Veteran Reacts" is monetized! Since Mar 8, 2021, the channel has generated 116,641,354 views. Assuming all views were monetized from day 1* with an average RPM of $3.00, this channel has generated $349,924.06 over 871 days. That's an average of $146,638.67 per year.

"Combat Veteran Reacts gives my take on military themed movies, films, documentaries, video games, and more! We learn about tactics, strategy, history, and technology as we look with a critical eye at representations of conflict and war in media!" and "Location: United States"

Source: https://www.youtube.com/@CombatVeteranReacts/about

One notices Johns Hopkins University degree on the back wall, of this United States based YouTube content creator. Appears on his own website, TikTok, Facebook, Instagram and Discord, as well as one a second YouTube channel -- with "an Amazon Associate I earn from qualifying purchases" and a "merch" store --

https://www.youtube.com/@MilitaryHistoryGearReview/store

$19.9K - $317.9K ESTIMATED YEARLY EARNINGS

Source: https://socialblade.com/youtube/c/combatveteranreacts

And he seeks paid subscribers to his website -- https://www.combatvetnews.com/become-a-member

Inteesting too that the "become a member" buttons are live, while the "about" button is not activated.

It is interesting how many sources for the Ukraine-Russia war re-package for "content" -- meaning audio-visual presentation -- are uploaded from the United States, sell "merch" and many seek "donations" and clicks. The cottage industry grown up around the war will be in deep trouble when the war is over. Cash flows aplenty will dry up. Maybe YouTube's 45% of the income will dry up too?

Major General Smedley Butler seems to have foreseen today.

55 posted on 10/04/2023 6:44:39 AM PDT by Worldtraveler once upon a time (Degrow government)
[ Post Reply | Private Reply | To 51 | View Replies]

To: kiryandil

😂😂🤣🤣


56 posted on 10/04/2023 6:51:07 AM PDT by Allegra (Stop the Zeepers from Censoring FReepers)
[ Post Reply | Private Reply | To 41 | View Replies]

To: doorgunner69

“spelling Russia with “z” “

Ruzzian - Alternative spelling of Russian.
Noun
Ruzzian (plural Ruzzians)

ETYMOLOGY
Neologism [new word, expression] following the 2022 Russian invasion of Ukraine.

Ruzzian is a blend of Russian +‎ Z, using the Russian Z SYMBOL as substitute in Russian propaganda against the Russian invasion of Ukraine.

It may also be considered a etymology parody for Russian. :)


57 posted on 10/04/2023 7:38:09 AM PDT by UMCRevMom@aol.com (Pray for God's intervention to stop Putin's invasion of Ukraine )
[ Post Reply | Private Reply | To 43 | View Replies]

To: House Atreides

HELPFUL SITE FOR YOU:

USDA Logo U.S. Department of Agriculture
Grants and Loans

https://www.usda.gov/topics/farming/grants-and-loans


58 posted on 10/04/2023 7:41:32 AM PDT by UMCRevMom@aol.com (Pray for God's intervention to stop Putin's invasion of Ukraine )
[ Post Reply | Private Reply | To 47 | View Replies]

To: AdmSmith; AmericanInTokyo; Apparatchik; AZJeep; BabaOreally; babble-on; BeauBo; bert; blitz128; ...

VIDEO-ARTICLE COMMENTARY

Ukrainian Drones GOT BEHIND Air Defense and MASSIVELY Strike Russian Aircraft Plant | Ukraine War
Divine Justice
Oct 4, 2023

https://www.youtube.com/watch?v=ljsi4GHT4Zc

& English language Closed Caption & Transcript available


59 posted on 10/04/2023 7:43:14 AM PDT by UMCRevMom@aol.com (Pray for God's intervention to stop Putin's invasion of Ukraine )
[ Post Reply | Private Reply | To 54 | View Replies]

To: AdmSmith

Helpful hint for Worldtraveler once upon a time:

“YouTube content creators’ channels are able to benefit from the 1st Constitutional Amendment that prohibits: ‘the free exercise of religion, or abridge the freedom of speech, the freedom of the press.’”


60 posted on 10/04/2023 7:45:54 AM PDT by UMCRevMom@aol.com (Pray for God's intervention to stop Putin's invasion of Ukraine )
[ Post Reply | Private Reply | To 55 | View Replies]


Navigation: use the links below to view more comments.
first previous 1-2021-4041-6061-73 next last

Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.

Free Republic
Browse · Search
General/Chat
Topics · Post Article

FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson