Free Republic
Browse · Search
General/Chat
Topics · Post Article

Skip to comments.

Thin-skinned 5ft 7in Putin has secret team dedicated to protecting him from memes portraying him as a dwarf, Hitler or a crab
Daily Mail ^ | 2/10/2023 | Chris Jewers

Posted on 02/11/2023 6:50:33 AM PST by marcusmaximus

click here to read article


Navigation: use the links below to view more comments.
first previous 1-2021-4041-6061-72 last
Comment #61 Removed by Moderator

To: Renfrew

I’m 6’2”. My rage is more likely from Irish DNA or living around Philly.


62 posted on 02/11/2023 10:49:42 AM PST by EEGator
[ Post Reply | Private Reply | To 61 | View Replies]

To: wildcard_redneck

According to polls there are less Americans who like Putin than those who believe in werewolves.


63 posted on 02/11/2023 11:48:12 AM PST by Krosan
[ Post Reply | Private Reply | To 18 | View Replies]

To: marcusmaximus
Let's see, Sarkozy is 5'5", but is known to wear elevator shoes, plus he has at least an inch of hair on top.


64 posted on 02/11/2023 11:50:13 AM PST by Albion Wilde ("There is no good government at all & none possible."--Mark Twain)
[ Post Reply | Private Reply | To 1 | View Replies]

To: Sunsong
"pooty has ‘little man’ syndome"
I was 6ft3 in my youth (down to 6ft2 in old age), but I always thought 5ft7 was about standard male height.
65 posted on 02/11/2023 11:51:29 AM PST by Hiddigeigei ("Talk sense to a fool and he calls you foolish," said Dionysus - Euripides)
[ Post Reply | Private Reply | To 60 | View Replies]

To: Hiddigeigei

quick google:

“Average height for men in the United States
According to the Centers for Disease Control and Prevention (CDC) , the average age-adjusted height for American men 20 years old and up is 69.1 inches (175.4 centimeters) during the years 2015 to 2016. That’s about 5 feet 9 inches tall.”


66 posted on 02/11/2023 12:14:49 PM PST by Sunsong
[ Post Reply | Private Reply | To 65 | View Replies]

To: njslim

Have you ever seen Zelensky? He’s shorter than Putin, but the Bidenistas conveniently forget that fact when posting their childish drivel.


67 posted on 02/11/2023 12:53:08 PM PST by CrimsonTidegirl (The fate of all mankind, I see, is in the hands of fools.- King Crimson)
[ Post Reply | Private Reply | To 5 | View Replies]

To: marcusmaximus

Putin wears high heels. Putin’s Napoleon complex or how to look 15 cm taller.

https://www.youtube.com/watch?v=lY6lHjZjYXE


68 posted on 02/11/2023 2:26:25 PM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 1 | View Replies]

To: marcusmaximus

So this report is a report on memes denigrating Putin that Putin never sees? I’d be more concerned if Putin was looking at any of that.

Meanwhile, a far more interesting report would be on how over half the American public — and every Democrat — is shielded from actual news that would otherwise contradict their preconceptions, and how when they are actually confronted with it, their confirmation bias denies the plain evidence.


69 posted on 02/11/2023 4:02:44 PM PST by nicollo ("I said no!")
[ Post Reply | Private Reply | To 1 | View Replies]

To: Prince of Space

I would call 5 ft. 7 exactly ‘’short’’.


70 posted on 02/12/2023 3:29:41 AM PST by jmacusa (Liberals. Too stupid to be idiots. )
[ Post Reply | Private Reply | To 9 | View Replies]

To: All
A newspaper once reported that there was criteria for the height of people in official photos with him, and that they shouldn't be taller. Shockingly, the newspaper said "Vladimir is believed to be between 5ft 2" and 5ft 5" .
71 posted on 02/12/2023 9:09:41 PM PST by UMCRevMom@aol.com (Pray for God's intervention to stop Putin's invasion)
[ Post Reply | Private Reply | To 70 | View Replies]

To: Renfrew

I’m a woman, FFS! And you’re an a$$.


72 posted on 02/14/2023 1:18:15 AM PST by Prince of Space (Let’s Go, Brandon! )
[ Post Reply | Private Reply | To 14 | View Replies]


Navigation: use the links below to view more comments.
first previous 1-2021-4041-6061-72 last

Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.

Free Republic
Browse · Search
General/Chat
Topics · Post Article

FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson