Free Republic
Browse · Search
General/Chat
Topics · Post Article

Skip to comments.

Iranian Regime tv Channel One hacked while it was airing Khamenie speech
various | 10-8-22

Posted on 10/08/2022 1:05:38 PM PDT by nuconvert

Iranian Regime national tv Channel One hacked about an hour ago. During a broadcast of Khamenie speech, a red crosshair appeared over his face and chanting of Women. Life. Freedom. There was writing to the side saying "Rise up. Join us". Also 4 photos at the bottom of the screen of young people killed and additional writing: "The blood of our youth is dropping from your paws".

Also, there was a huge banner in the middle of Tehran highway today that read: We are no longer afraid of you. We will fight.

Also, attempted attack on IRI ambassador in Denmark. Her bodyguard was stabbed. Diplomatic Security intervened before the attacker could stab the ambassador.


TOPICS:
KEYWORDS: basij; deathtothemullahs; denmark; ebrahimrigi; erdogan; iran; iranprotests; iraq; irgc; iri; israel; khameini; khamenei; kurdistan; lebanon; mahsaamini; mullahloversonfr; mullahsmustbekilled; najisharifizindashti; protests; qudsforce; raisi; receptayyiperdogan; shahrammaroufmola; syria; turkey; yemen; zahedi
Navigation: use the links below to view more comments.
first previous 1-20 ... 1,921-1,9401,941-1,9601,961-1,980 ... 2,381-2,394 next last

If you’re looking for a polite take, this isn’t it.

I’ve said it repeatedly on the Conflicted podcast: Pakistan was never a neutral mediator between Washington and Tehran. Not for a second. What we’re watching now is not diplomacy, it’s pure manipulation dressed up as statecraft.

Let’s call things by their proper names. Under field marshal Asim Munir, Pakistan isn’t some balanced civilian democracy playing honest broker. It’s a military system with a democratic façade, pursuing its own interests with a level of cynicism that should surprise no one who has followed its behavior over the past two decades. What did they sell to Donald Trump? A fantasy. A pipe dream. That the Islamic Republic can be reasoned with. That it is pragmatic, not ideological. That it is capable of compromise if only you flatter it enough and give it incentives. In short: that you can extract “the deal of the century” from a regime whose entire strategic doctrine is built on resisting precisely that outcome. And Trump - obsessed with the optics of a deal - bought it.

Meanwhile, senior voices inside Pakistan weren’t even pretending neutrality. A defence minister pushing conspiratorial narratives, blaming the “Zionists,” portraying Iran as a victim, while 6,000 missiles and drones were raining down on GCC states that host millions of Pakistani workers. That alone should have been disqualifying. If a country is willing to throw its own economic lifeline (the Gulf) under the bus for ideological or tactical alignment with Tehran, what exactly makes anyone think it would safeguard American interests?

And here’s the uncomfortable part: this isn’t new. We’ve seen this movie before. The United States spent years, treasure, and blood in Afghanistan, only to discover that Osama bin Laden, and his network, were living comfortably in Pakistan all along - while Pakistan was simultaneously cashing in on US counterterrorism billions in funding. They didn’t fail to find the target. They bloody managed it. Why end the hunt when the hunt itself pays and pays pretty well?

Fast forward to today, and the pattern repeats, only this time the battlefield is Iran. At the very moment the regime was under maximum pressure (militarily strained, economically cornered, strategically exposed) Pakistan steps in, not to mediate, but to buy Tehran time. Time to regroup, breathe, and ultimately survive. That’s not mediation. That’s intervention - on one side. From a cold, historical lens, this may well be remembered as the pivot point. The moment when pressure was lifted prematurely. When momentum was lost. When a winnable strategic position was traded for the illusion of a negotiated breakthrough that was never going to materialise, ever!

Five years from now, looking back, this could read like a familiar chapter:
First Afghanistan - undermined from within.
Now Iran - diluted from without.

In both cases, Pakistan didn’t just mislead Washington. It shaped the battlefield to its advantage, all while claiming partnership with a clueless US administration. And Washington, once again, chose to believe what it wanted to hear.

https://x.com/AimenDean/status/2046837574447267847


1,941 posted on 04/21/2026 11:38:57 PM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 1940 | View Replies]

To: AdmSmith; nuconvert; BeauBo; ETCM

Unfortunately, IRGC has a lot more weapons than Parliament. I suspect that our President will have to bomb out a few hundred thousand more IRGC and Basij before saner and less ideological heads can prevail. Our Congress critters also need more information on just how brutal and evil the treatment of the protesters has been by these fanatics.

President Trump expressed considerable concern about how they had posted snipers to shoot protesters, and how when 5 or more women would end up with a bullet in their head, protesters have understandably been reluctant to stick around protesting. I don’t know if he has ever mentioned the many thousands of protesters who were deliberately blinded by small shot directly aimed at their faces. We also have not heard much about how these creeps would go to hospitals and grab or kill people who had been wounded while demonstrating.

So whether it is 32,000 or 90,000 killed for demonstrating this year, that is too damned many for American tastes. And all this because one woman, Kurdish I might add, objected to some strange man telling her she could not have a little bit of hair showing from under her required scarf.


1,942 posted on 04/22/2026 3:53:26 AM PDT by gleeaikin (Question Authority: report facts, and post their links" in your message)
[ Post Reply | Private Reply | To 1940 | View Replies]

Iran Update Special Report, April 22, 2026

The Islamic Revolutionary Guards Corps (IRGC) Navy attacked and likely redirected two vessels towards Iran on April 22, likely to enforce Iranian claims of sovereignty over the strait to disrupt global shipping and extract US concessions. The IRGC claimed that it “seized” two vessels and directed them to the Iranian coast on April 22.[1] The two vessels — the Liberian-flagged, Greek-owned Epaminondas and the Panamanian-flagged MSC Francesca — appear to have been exiting the Strait of Hormuz at the time of the attacks.[2] An IRGC “gunboat” inflicted “heavy damage” to the Epaminondas’s bridge, and an unspecified attack damaged the MSC Francesca's hull and accommodation.[3] Both vessels changed direction, sailed into Iranian territorial waters, and idled about seven nautical miles off the coast of Iran. Commercially available maritime tracking data showed that the Epaminondas continued to transit north in Iranian territorial waters. It is unclear why the vessels would have changed course and sailed further inland towards the Iranian coast if not under Iranian escort. The IRGC also fired on a third vessel, the Panamanian-flagged, Emirati-operated Euphoria, but the vessel continued its transit after the incident.[4] The IRGC has demanded that the United States lift its blockade over the Strait of Hormuz and effectively halted traffic through the strait on April 18 by attacking several vessels.[5] The IRGC likely aims to raise international shipping prices to extract concessions from the United States, such as ending the US blockade or yielding other demands. The IRGC also may have redirected the two vessels in response to the recent US Navy seizure of the Iranian-flagged, US-sanctioned Touska in the Gulf of Oman on April 19.[6] The Iranian regime had pledged to respond to the incident.[7]

The IRGC has also used its “control” over the strait as a means for IRGC Commander Major General Ahmad Vahidi to flex his own power over internal rivals, such as Parliament Speaker Mohammad Bagher Ghalibaf. Vahidi and his inner circle recently used the IRGC’s leverage over the strait to exercise influence over Iran's negotiating position.[8] The United States extended the ceasefire yesterday to allow for Iranian leaders to produce a “unified proposal,” but Iranian leaders remain fragmented over Iran's negotiating strategy, as noted below.[9]

The IRGC’s attacks on shipping and IRGC Commander Major General Ahmad Vahidi’s apparent willingness to scrap US-Iran talks indicate that Vahidi is prepared to resume the war if needed. Vahidi currently holds the most influential position in the regime at this time, apart from the Supreme Leader, who is reportedly seriously injured or incapacitated.[10] The IRGC’s recent attacks on commercial vessels suggest that Vahidi is willing to risk incurring a potential US military response to assert Iranian ”control” over the strait and achieve the subsequent intended effects, as described above. Vahidi also may seek to derail the negotiations and may be attempting to do so by introducing preconditions and interfering with efforts to produce a “unified proposal.”[11] These actions suggest that Vahidi and his inner circle have accepted and are prepared for the risks that such actions would lead to the resumption of the war with the United States.

Iranian decision-making remains fragmented and in disarray, which explains Iran's inability to formulate and communicate a coherent negotiating position. ISW-CTP previously assessed on April 15 that the United States is negotiating with a divided committee of hardliners and pragmatists that lacks a cohesive and unified position.[12] This intra-regime division has continued in recent days as senior Iranian officials have publicly diverged over negotiations.[13] Some reporting indicates that key actors, including Parliament Speaker Mohammad Bagher Ghalibaf and Foreign Affairs Minister Abbas Araghchi, lack the authority to represent the regime's position.[14] Iranian officials have not reached a unified decision on whether to return to negotiations in recent days, and competing regime power centers appear to be blocking consensus on core issues.[15] Iranian Foreign Affairs Ministry Spokesperson Esmaeil Baghaei told the BBC on April 21 that Iran has made “no decision” on whether to send a delegation to Islamabad and said officials continue to discuss conditions for returning to negotiations.[16] CNN reported on April 22 that US officials believe that intra-regime factions prevented a response to the US ”list of broad points.”[17] An unspecified US official told Axios on April 22 that there has been “an absolute fracture” between the negotiating team and the military and assessed that neither side has access to the supreme leader.[18] Axios added that IRGC leadership rejected much of what Iranian negotiators discussed with the United States after the first round of talks, which indicates that the negotiating team lacked the authority to represent the regime's position.[19]

The regime's formal decision-making and coordinating mechanisms are also not functioning effectively, instead reinforcing fragmentation. An unspecified US official told Axios on April 22 that Iran's Supreme National Security Council (SNSC) Secretary Mohammad Bagher Zolghadr is not effectively coordinating between the IRGC, civilian leadership, and the supreme leader, which suggests that overlapping authorities and factional disputes are delaying Iranian decision-making and preventing the regime from presenting a unified negotiating position.[20] Vahidi reportedly pressured President Masoud Pezeshkian to appoint Zolghadr, which may have increased Zolghadr’s challenges in fulfilling his duties as a key coordinator between Vahidi and other leaders.[21] The SNSC is formally responsible for aligning national security and foreign policy decision-making across the Iranian system and for generating consensus among key regime stakeholders, including civilian leadership and military commanders.[22] The apparent inability of the SNSC to produce a unified negotiating position or coordinate between competing actors suggests that the regime's primary decision-making mechanism is not functioning effectively.

US officials are increasing pressure on Iran to produce a unified response, however. Unspecified US officials told Axios on April 22 that US President Donald Trump is giving Iran a limited window of several days to present a coherent counteroffer before reconsidering military action.[23] Pakistani officials and intermediaries have simultaneously worked to keep talks “alive” and tried to secure a response from Iran, according to the Associated Press.[24] Iranian officials have continued to frame US actions, particularly the naval blockade, as the primary obstacle to negotiations, however.[25] Senior Iranian figures, including President Masoud Pezeshkian, have emphasized that “breach of commitments,” blockade measures, and threats prevent “genuine negotiations.”[26] An adviser to Ghalibaf stated on April 22 that the ceasefire extension ”has no meaning” and called for a military response to the US blockade.[27]

US officials have recently leaked quantitative estimates of the number of different Iranian assets remaining after the ceasefire. It is extremely difficult to deduce the degree of degradation to Iranian forces based on these estimates because the number of remaining systems is only one of many data points required to form a complete evaluation of military strength. Recent US intelligence assessments indicate that roughly 50 percent of Iran's ballistic missile stockpile and its launch systems remain “intact,” about 60 percent of the IRGC Navy still exists, and two-thirds of Iran's air force remains operational.[28] Some of these numbers are vague and incomplete. It is unclear, for example, what assets are included in the determination that 60 percent of the IRGC Navy is “still in existence.” Other issues exist with these numbers because military strength and the capabilities of a military organization rest on more than sheer numbers. The leaks assert that “two-thirds” of Iran's Air Force remains operational, but it is unclear what that two-thirds includes and the quality of operational aircraft. There are significant qualitative differences between Iran's F-4s and F-5s (both first flew in the late 1950s, and the United States flew in Vietnam) and the American and Israeli F-35. The size of the remaining missile stockpile is relevant, but a missile force is more than its stockpile; a more complete assessment would include assessments of the status of the personnel, command and control networks, production networks, logistics assets, and more. US air campaigns seek to achieve qualitative effects, some of which are invisible in the open-source information space, and others are difficult to observe because the effects take considerable time to become apparent.[29] Assessments that rely only on quantitative measures can overlook these critical effects and therefore fail to sufficiently evaluate the campaign.

Hezbollah has continued to conduct attacks for the second consecutive day despite the Israel-Lebanon ceasefire.[37] Hezbollah claimed that it conducted two attacks targeting Israeli forces in southern Lebanon on April 22.[38] Hezbollah previously conducted two attacks on Israeli forces in southern Lebanon and northern Israel on April 21, for the first time since the Israel-Lebanon ceasefire took effect on April 16.[39] Hezbollah claimed an attack with two first-person view (FPV) drones targeting IDF personnel and a command vehicle in Qantara, Marjaayoun District.[40] The Israel Defense Forces (IDF) intercepted one Hezbollah drone over Bayyada, Tyre District, and the attacks caused no reported casualties.[41]

The Lebanese government has continued to take steps to disarm Hezbollah in Lebanon. Lebanese President Joseph Aoun instructed the Lebanese Armed Forces (LAF) and other Lebanese security forces to intensify raids on weapons caches in Beirut and other areas of Lebanon during a security meeting on April 22.[55] Aoun said that Lebanese security services should show “no leniency” to “any party” since “no one” is allowed to obstruct the Lebanese government's implementation of security measures and the Lebanese state's monopoly over weapons.[56] Aoun emphasized that maintaining civil peace in Lebanon is a “red line.”[57] Lebanese Prime Minister Nawaf Salam ordered the LAF on April 9 to immediately enforce the Lebanese state's monopoly over weapons in Beirut.[58] Lebanese media reported on April 10 that the Lebanese Armed Forces deployed units, including soldiers from its Commando Regiment, to secure the Government Palace and begin patrols in Beirut.[59]

US and Iraqi officials told the Wall Street Journal on April 22 that the US Treasury Department has temporarily halted shipments of Iraq's oil export revenue via the US Federal Reserve due to concerns about Iranian-backed Iraqi militia behavior.[66] The officials said that the United States first blocked a shipment of dollars to the Central Bank of Iraq when the war began in late February 2026, and recently blocked a cargo plane delivery of nearly $500 million in US banknotes.[67] The Central Bank of Iraq has managed an account at the New York Federal Reserve on behalf of the Iraqi Finance Ministry since 2003 that holds the Iraqi federal government's revenue from oil exports in US dollars.[68] Oil revenue accounts for about 90 percent of the Iraqi state's budget.[69] US officials confirmed the temporary hold on Iraq's dollar shipments to the Wall Street Journal.[70] The United States has previously threatened such action, such as when the United States reportedly warned Iraqi officials in early February 2026 that the United States would reduce Iraq's access to oil export revenues if State of Law Coalition head Nouri al Maliki becomes prime minister again.[71]

https://understandingwar.org/research/middle-east/iran-update-special-report-april-22-2026/

1,943 posted on 04/23/2026 12:33:30 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 1940 | View Replies]

Sal Mercogliano- What’s Going on With Shipping?
22APR2026 Boarded and Diverted | Three MSC Containerships Fired Upon By Iran | US Diverts Iranian Tankers

https://www.youtube.com/watch?v=W__UF5R0Dok


1,944 posted on 04/23/2026 12:38:58 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 1934 | View Replies]

Health authorities in areas controlled by Yemen's internationally recognized government (IRG) announced Wednesday that measles has killed 36 people and infected more than 7,000 since the start of 2026, raising alarm over the worsening outbreak.

According to Taysir Al-Samie, health media officer in Taiz governorate, a total of 7,140 cases were recorded over three and a half months. April alone saw 15 child deaths and 1,541 new infections. Al-Samie said most fatalities occurred among unvaccinated children, urging parents to complete immunization schedules. He stressed that vaccines are available in government-held areas, where routine campaigns are being conducted. He noted that last year, 2025, saw over 16,000 infections and 106 deaths, underscoring the persistence of the epidemic at high levels. Weak vaccination campaigns, particularly in Houthi-controlled regions, have contributed to the spread, increasing risks for children.

https://yemenonline.info/special-reports/12386

One dose is approximately 93% effective, while two doses increase protection to 97%. In the rare event a fully vaccinated child gets measles, it is often due to a weak immune response to the vaccine or extremely close, prolonged exposure to the virus. Vaccinated individuals who get measles typically experience milder illness, such as a lower-grade fever, fewer coughs, and a milder rash compared to unvaccinated individuals.

1,945 posted on 04/23/2026 1:36:45 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 1944 | View Replies]

To: nuconvert; BeauBo; blitz128
Iran Update Special Report, April 23, 2026

US President Donald Trump's messages have appeared to elicit a choreographed response by the Iranian regime that is directed both to regime factions and to the United States. The choreographed response was an attempt to portray unity between the “moderate” and “hardliner” factions in the regime by stating the same message affirming belief in the Islamic Revolution's core values. Trump stated on Truth Social on April 23 that Iran is “having a hard time figuring out who their leader is.”[1] Trump highlighted infighting between the regime's “moderate” and “hardliner” factions, adding that the United States will maintain the blockade on Iranian ships and ports until the regime is “able to make a deal.”[2]

The heads of Iran's three branches of government–Iranian President Masoud Pezeshkian, Judiciary Chief Gholam Hossein Mohseni Ejei, and Parliament Speaker Mohammad Bagher Ghalibaf–issued a series of statements aimed at defending themselves from accusations of “moderation” in the Islamic Revolutionary context. Pezeshkian, Ejei, and Ghalibaf published nearly identical messages on X on April 23 in which they emphasized their allegiance to the principles of the Islamic Revolution.[3] All three leaders rejected that the regime contains “hardline” and “moderate” factions and circulated the slogan “One God, one nation, one leader, and one path—the path of victory for Iran.” Ejei published the statement first, followed by Pezeshkian and Ghalibaf. Ejei, while a hardliner historically, allied with the pragmatic Iranian leaders during efforts to end the 12-Day War.[4] Iranian Foreign Affairs Minister Abbas Araghchi, who, along with Ghalibaf, has been leading Iran's negotiating delegation, posted a similar message on X in which he emphasized the regime's unity.[5] Senior IRGC commanders such as Vahidi and SNSC Secretary Mohammad Bagher Zolghadr did not circulate similar statements, but other IRGC-affiliated figures did several hours after Pezeshkian, Ejei, and Ghalibaf’s messages (see more below).

The publication of these messages and the context of the events surrounding them indicate that Pezeshkian, Ghalibaf, Ejei, and Araghchi likely sought to defend themselves from accusations of moderation, which Vahidi could use to challenge their commitment to the revolution. Araghchi, Ghalibaf, and Pezeshkian have adopted a more pragmatic approach toward the United States in negotiations, a stance that Vahidi and those close to him likely view as a diversion from the ideals of the Islamic Revolution. Vahidi attempted to insert Zolghadr into the first round of negotiations with the United States in Pakistan despite the protests of Araghchi and Ghalibaf.[6] Vahidi almost certainly did this to ensure that someone from his inner circle could keep tabs on whether Araghchi or Ghalibaf tried to negotiate outside of Vahidi’s red lines, which include maintaining support for the Axis of Resistance, recognizing Iran's “right” to enrich uranium, and preserving Iran's “control” over the Strait of Hormuz. US officials told Axios on April 20 that the US negotiating delegation thought it was “negotiating with the right people“ in Islamabad on April 11 and 12, but that the IRGC effectively told the Iranian negotiating delegation upon their return to Tehran that the negotiating team ”[does not] speak for” the IRGC.[7] Ghalibaf publicly defended the approach of negotiating with the United States in a speech on April 18 and criticized hardline officials–including SNSC member Saeed Jalili and hardline parliamentarian Amirhossein Sabeti–for their opposition to negotiations during a meeting with advisers.[8] ISW-CTP previously assessed that Ghalibaf’s criticism was likely implicitly aimed at Vahidi because Vahidi also opposes negotiating with the United States.[9]

Iranian Supreme Leader Mojtaba Khamenei acknowledged Ghalibaf, Pezeshkian, Ejei, and Aragchi’s obeisance several hours later in a choreographed manner that likely seeks to demonstrate unity and signal an end to the internal competition between pragmatic and hardliner officials. Mojtaba suggested that the statements represented a spontaneous unification of the regime's divided factions and portrayed this unification as a direct response to Trump's statement. ISW-CTP has rendered Mojtaba’s statement in English below:

“Due to the extraordinary unity forged among our compatriots, a fracture has appeared within the enemy. With active gratitude for this blessing, our cohesion will become stronger and more ironclad, and the enemies will be further humiliated and disgraced. The enemy media operations, by targeting the minds and souls of the people, aim to undermine national unity and security; May this evil intention not be realized due to our negligence.”[10]

IRGC-affiliated Tasnim News Agency portrayed the messages solely as a response to recent comments from Trump.[11] It is not clear who is writing Mojtaba’s online messages, given that he is in poor physical condition (see below).

A number of IRGC and IRGC-affiliated regime figures posted similar statements hours after the “moderates’” statements to express agreement with and support for Mojtaba’s position. These messages present an apparent unified front against the United States. But they also allow the IRGC to deflect attempts by pragmatists to blame the IRGC or hardliners if war resumes by spreading the blame across the entirety of the ”unified” government. Figures like IRGC Aerospace Commander Brigadier General Majid Mousavi, former SNSC Secretary Ali Akbar Ahmadian, IRGC Quds Force Commander Brigadier General Esmail Ghaani, and Artesh Commander Major General Amir Hatami posted messages affirming the “One God, one nation, one leader, and one path” message and unity against the United States.[12]

Iranian Supreme Leader Mojtaba Khamenei is likely unable to seriously impact Iranian decision-making due to injuries sustained during the war, however. The New York Times reported on April 23 that Mojtaba is under frequent medical attention and heavily reliant on the advice and guidance of senior IRGC commanders led by Vahidi, citing a number of former IRGC and current regime officials.[13] One adviser to former Iranian President Mahmoud Ahmadinejad stated that Mojtaba is running the country like it is a company board, with the senior IRGC commanders as the members of the board. The report noted that regime officials have difficulties communicating with Mojtaba, including because they needto send messages secretly and via multiple runners. The article also noted that Mojtaba has been heavily influenced by IRGC commanders due to his close historical ties with them from the Iran-Iraq War. Supreme Leader Military Affairs Adviser Major General Yahya Rahim Safavi has reportedly served as Mojtaba’s top military adviser, as he did with Mojtaba’s father, Ali Khamenei. The New York Times report is consistent with ISW-CTP’s assessment at the time of Mojtaba’s assumption of power that he would likely be influenced by the more hardline elements of the Iranian regime due to his close ties to them.[14]

Vahidi continues to support Iranian sovereignty over the Strait of Hormuz and efforts to retain the nuclear program, because he views negotiations with the United States as having no present value, according to IRGC sources and anti-Iranian regime media.[15] An IRGC‑affiliated outlet argued on April 22 that negotiations over the Strait of Hormuz are “unnecessary” because such negotiations would signal doubt over Iran's sovereignty over the Strait of Hormuz.[16] The same outlet stated that negotiations under these conditions would grant the United States a low‑cost victory and violate declared red lines, particularly on Iran's nuclear file and “regional cooperation,“ which is likely a euphemism for the Axis of Resistance.[17] Senior Iranian parliamentarians broadly echoed this hardline posture on April 22 and 23 by portraying negotiations as damaging to deterrence and acceptable only under tightly constrained, Iranian‑defined terms.[18] Anti-regime media reported on April 23 that Mojtaba’s office, which Vahidi appears to run, opposed the discussion of the nuclear issue.[19] Araghchi reportedly contended that, under the Supreme Leader's orders, participation in negotiations offers little benefit and effectively amounts to a “death sentence” for the talks.[20] Vahidi and several other generals reportedly did not see the point in negotiating with the United States because the US naval blockade of Iran demonstrated that US President Donald Trump was not interested in negotiations and instead sought to pressure Iran to surrender, according to officials and two members of the IRGC briefed on the meeting who spoke to the New York Times on April 23.[21] Pakistani officials told Saudi media on April 23 that Iran-Pakistan contact continues, but confirmed that discussions are stalled due to Iranian opposition to the US naval blockade.[22] The officials noted that Iran has not formally responded to the possibility of future talks.[23] These reports of Vahidi’s unwillingness to negotiate are consistent with ISW-CTP’s April 22 assessment that Vahidi is deliberately accepting the risk of potential US military response to assert Iranian ”control” over the Strait of Hormuz.[24]

Vahidi is part of the first generation of revolutionaries, and he prioritizes ideological purity and hard power over the economy and well-being of Iranian citizens. The regime figures who appear more pragmatic and are concerned with the economy — Pezeshkian and Ghalibaf — also appear to have accepted Vahidi’s positions in pursuit of unifying the Iranian political class.[25] Pezeshkian and Araghchi disagreed with Vahidi and other IRGC officials’ view that talks are pointless, according to officials and two members of the Guards briefed on the meeting who spoke to the New York Times on April 23.[26] Pezeshkian also warned that financial gains from negotiations — likely in reference to the lifting of the naval blockade, sanctions relief, and the unfreezing of Iranian assets abroad — are needed to pay for the estimated $300 billion in losses from war with the United States and Israel.[27] Vahidi and the IRGC dismissed Pezeshkian’s concerns over the economy, as they have done since the start of the war, according to anti-regime media.[28] Vahidi almost certainly gives precedence to ideological orthodoxy and hard power over ideological flexibility that would present the sort of agreement that would dampen economic challenges. Hard power, in this logic, is essential for the Iranian regime's control over Iran from both internal and external threats. Economic distress remains one of the regime's most significant internal vulnerabilities, as demonstrated by the December 2025–January 2026 protests.[29] Ideologically orthodox revolutionaries who prioritize hard power believe that such vulnerabilities can be guarded against through force.

https://understandingwar.org/research/middle-east/iran-update-special-report-april-23-2026/


1,946 posted on 04/24/2026 12:34:40 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 1943 | View Replies]

To: nuconvert
Iran's Supreme Leader Is Mentally Sharp. He Just Can't Run a Ceasefire.

Brigadier General Salar Velayatmadar — an IRGC commander who sits on Parliament's National Security and Foreign Policy Committee, which means he is not a fringe figure but a senior official with formal oversight responsibilities — offered what remains the only official acknowledgment that a deliberate media blackout exists. “Based on the opinion of scholars in Najaf, Qom and Mashhad and the decision of security officials,” he told Iran International, “no new images or materials of him will be released for now so that enemies cannot harm him through particular methods and occult sciences,” adding that such sciences are studied at institutions “including those in Tel Aviv.”

This statement deserves parsing not for its supernatural content but for its bureaucratic architecture. Velayatmadar cited three sources of authority for the media ban: religious scholars across three seminary cities (Najaf, Qom, Mashhad — notably spanning Iraqi and Iranian institutions), unnamed “security officials,” and an implied Israeli threat vector that he chose to describe in occult rather than intelligence terms. The layered sourcing suggests not a spontaneous remark but a prepared position, an official line distributed to IRGC-aligned officials for use when the absence question becomes unavoidable, which — forty-six days in, with CNN running AI-generated deepfake analysis and Time magazine headlining “Iran's Supreme Leader No Longer Reigns Supreme” — it has.

What Velayatmadar did not explain is how a Supreme Leader who cannot be shown, heard, or visited by his own military commanders can exercise the constitutional functions that Article 110 assigns exclusively to his person: supreme command of the armed forces, declaration of war and peace, and the resolution of disputes between branches of government. The occult sciences rationale covers the media absence; it does not cover the operational absence, and the two are not the same problem.

Because Article 110 vests supreme command in the Supreme Leader as a person, not a position. Without a leader who can meet commanders, issue verbal directives, and respond in real time, no subordinate official — not the President, not the Foreign Minister — can make commitments the IRGC is constitutionally bound to honour. The authority cannot be delegated downward; it can only be absent.

The authorization ceiling — the structural inability of any Iranian official below the Supreme Leader to make ceasefire commitments that the IRGC will honour — has been analysed extensively in these pages as a governance problem: Pezeshkian’s zero authority over the military under Article 110, the IRGC’s repeated overrides of Foreign Ministry positions (most dramatically when Araghchi declared Hormuz “completely open” on April 17 and was reversed within hours by IRGC joint command), and the Supreme National Security Council's effective capture by IRGC-aligned figures including Vahidi and Zolghadr. All of that analysis remains correct. What the NYT report adds is the missing causal layer: these aren't features of the system working as designed — they are symptoms of the system operating without its capstone.

Mojtaba Khamenei cannot summon commanders because visitors risk exposing his location to Israeli tracking. He cannot issue verbal directives because his burns make speaking difficult. He cannot respond in real time because his communication travels by motorcycle. And he lacks the accumulated relational authority that made his father's directives self-enforcing — the IRGC commanders who obeyed Ali Khamenei did so not only because of Article 110 but because they had spent decades inside a relationship of mutual obligation and tested loyalty that his fifty-six-year-old son, whose pre-war career was spent as a behind-the-scenes liaison and Basij controller, has not had time to build.

Mojtaba’s constitutional name provides cover for decisions the IRGC has already made without him; invoking Article 111 would retroactively delegitimise those decisions, trigger an Assembly of Experts process the IRGC cannot fully control, and create a Provisional Council that gives President Pezeshkian — explicitly excluded from actual power — one-third of Supreme Leader authority on paper.

Article 111 of the Iranian constitution provides explicitly for the scenario the country is now living through: “Whenever the Leader becomes incapable of fulfilling his constitutional duties, or loses one of the qualifications mentioned in Article 5 and Article 109, or it becomes known that he did not possess some of the qualifications initially, he will be dismissed.” In the interim, a Provisional Council of three — the President, the Head of the Judiciary, and one jurist from the Guardian Council — assumes leadership. The Assembly of Experts (now reduced from 88 members after the building housing it was destroyed, with eight members having boycotted the online vote that installed Mojtaba) has the constitutional authority to determine incapacitation and appoint a replacement.

read the article https://houseofsaud.com/mojtaba-khamenei-authorization-ceiling/

The Constitution of the Islamic Republic of Iran
Adopted on: 24 Oct 1979
Effective since: 3 Dec 1979
Amended on: 28 July 1989
ICL Document Status: 1992

Article 110 [Leadership Duties and Powers]

(1) Following are the duties and powers of the Leadership:
1. Delineation of the general policies of the Islamic Republic of Iran after consultation with the Nation's Exigency Council.
2. Supervision over the proper execution of the general policies of the system.
3. Issuing decrees for national referenda.
4. Assuming supreme command of the Armed Forces.
5. Declaration of war and peace and the mobilization of the Armed Forces.
6. Appointment, dismissal, and resignation of:
a. the religious men on the Guardian Council,
b. the supreme judicial authority of the country,
c. the head of the radio and television network of the Islamic Republic of Iran,
d. the chief of the joint staff,
e. the chief commander of the Isalmic Revolution Guards Corps, and
f. the supreme commanders of the Armed Forces.
7. Resolving differences between the three wings of the Armed Forces and regulation of their relations.
8. Resolving the problems which cannot be solved by conventional methods, through the Nation's Exigency Council.
9. Signing the decree formalizing the election of the President of the Republic by the people. The suitability of candidates for the Presidency of the Republic, with respect to the qualifications specified in the Constitution, must be confirmed before elections take place by the Guardian Council, and, in the case of the first term of a President, by the Leadership. 10. Dismissal of the President of the Republic, with due regard for the interests of the country, after the Supreme Court holds him guilty of the violation of his constitutional duties, or after a vote of the Islamic Consultative Assembly testifying to his incompetence on the basis of Article 89.
11. Pardoning or reducing the sentences of convicts, within the framework of Islamic criteria, on a recommendation from the Head of judicial power.
(2) The Leader may delegate part of his duties and powers to another person.

Article 111 [Leadership Council]

(1) Whenever the Leader becomes incapable of fulfilling his constitutional duties, or loses one of the qualifications mentioned in Articles 5 and 109, or it becomes known that he did not possess some of the qualifications initially, he will be dismissed. The authority of determination in this matter is vested with the experts specified in Article 108.
(2) In the event of the death, or resignation or dismissal of the Leader, the experts shall take steps within the shortest possible time for the appointment of the new Leader. Until the appointment of the new Leader, a council consisting of the President, head of the judiciary power, and a religious men from the Guardian Council, upon the decision of the Nation's Exigency Council, shall temporarily take over all the duties of the Leader. In the event that, during this period, any one of them is unable to fulfil his duties for whatsoever reason, another person, upon the decision of majority of religious men in the Nation's Exigency Council shall be elected in his place.
(3) This council shall take action in respect of items 1, 3, 5, and 10, and sections d, e and f of item 6 of Article 110, upon the decision of three-fourths of the members of the Nation's Exigency Council.
(4) Whenever the leader becomes temporarily unable to perform the duties of leadership owing to his illness or any other incident, then during this period, the council mentioned in this article shall assume his duties.

https://hrlibrary.umn.edu/research/iran-constitution.html

If you're going to live like it's the Middle Ages, you might as well go all out.

1,947 posted on 04/24/2026 3:28:39 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 1946 | View Replies]

To: AdmSmith

I read the other day about that statement of not allowing images of him and assumed he must have really severe facial injuries. Between that and leg amputation(s), he must be on heavy duty meds. IOW, not fit to perform his job


1,948 posted on 04/24/2026 4:16:27 AM PDT by nuconvert ( Warning: Accused of being a radical militarist. Approach with caution.)
[ Post Reply | Private Reply | To 1947 | View Replies]

To: AdmSmith

“Vahidi’s red lines, which include maintaining support for the Axis of Resistance, recognizing Iran’s “right” to enrich uranium, and preserving Iran’s “control” over the Strait of Hormuz”

Sounds like someone needs killing.

Alternatively, he might be useful for a short time, since he is so predictable, if we want someone to drive the regime over the cliff a little further, for a full regime change end state.

Anyway, the resumption of bombing seems to be only a matter of time. He is really asking for it. It might be hard to make it a surprise.


1,949 posted on 04/24/2026 8:01:34 AM PDT by BeauBo
[ Post Reply | Private Reply | To 1946 | View Replies]

To: BeauBo; nuconvert

If the Supreme S-t were to die, it would lead to a constitutional crisis, and the IRGC would lose its current advantage.


1,950 posted on 04/24/2026 8:54:50 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 1949 | View Replies]

To: AdmSmith

“If the Supreme S-t were to die”

When.

Another round of well targeted decapitation (the Intel Community has had a good opportunity to assess key figures responses in detail, for targeting/shaping) should bring us closer to an acceptable end state in Iran.

I saw a report that in addition to being crippled, Mojtaba is facially disfigured, lacking lips.

The next round of new leaders is going to inherit a seriously unmanageable mess, with little time or ability to orient, decide and act.


1,951 posted on 04/24/2026 9:27:50 AM PDT by BeauBo
[ Post Reply | Private Reply | To 1950 | View Replies]

To: AdmSmith; nuconvert; BeauBo; Political Junkie Too; BroJoeK; MalPearce; adorno; Jonty30; ...

I am currently reading the 2008 book by Nursultan Nazarbayev who succeeded in separating Kazakhastan from the old Soviet Union, and it’s Putin led replacement. In The Kazakkhstan Way he describes his experience and thinking as he tries to establish a successful independent country. Iran faces similar problems for the future without any stability created by a former high level manager from the old system, such as Nazarbayev. I knew he had remained in office or as a power for many more years after 2008 so asked AI about his overall rule both good and bad:

“AI Overview
==Nursultan Nazarbayev, leading Kazakhstan from 1989 to 2019, is credited with establishing a stable, internationally recognized state and developing its energy sector, attracting significant foreign investment. However, his regime was defined by rampant corruption, extreme nepotism, and the systematic elimination of political competition, transforming from a “modernizer” into an authoritarian “leader of the nation”.

*The “Good” (Constructive Leadership and Development):
—Economic Stability and Growth: Nazarbayev oversaw the transition to a market economy, leveraging rich oil and mineral resources to foster economic growth.
—Attracting Foreign Investment: He successfully presented Kazakhstan as a stable, open, and progressive business-friendly state, crucial for developing its energy sector.
—Geopolitical Balancing: He maintained a delicate balance between global powers, primarily Russia, China, and the United States, positioning Kazakhstan as a reliable regional partner.
—Nuclear Disarmament: In 1991, he led efforts to close the Semipalatinsk nuclear site and renounced the world’s fourth-largest nuclear arsenal, earning international acclaim.
—Infrastructure/Modernization: He built a new capital city, Astana (now temporarily renamed back from Nur-Sultan), as a symbol of modern Kazakhstan.

*The “Bad” (Authoritarianism and Corruption):
—Authoritarian Rule: Nazarbayev dismantled democratic processes, winning re-elections with implausible margins (over 95%), stifling media, and banning effective opposition.
—Endemic Corruption & Nepotism: His family and close circle accumulated massive wealth, controlling key industries and leaving a legacy of inequality.
—Repression of Dissent: His administration ruthlessly suppressed opposition, most notably in the 2011 Zhanaozen massacre of oil workers.
—Failed Succession Plan: Despite designing a transition to secure his family’s assets, the handover to Kassym-Jomart Tokayev was marred by instability, culminating in the 2022 violence that saw him lose power.
—Cult of Personality: He assumed the title “Leader of the Nation,” granting himself immunity from prosecution and installing himself as the focal point of the political system.

==Nazarbayev’s legacy is essentially a tale of two eras: initially creating a functioning state, but ultimately creating a personalized autocracy that struggled with corruption and succession.”

This AI SUMMARY contains many useful pieces of advice and information. As I continue reading the book I will make subsequent ideas and pieces of information available for those thinking about a positive future for Iran and it’s people.


1,952 posted on 04/24/2026 11:20:20 AM PDT by gleeaikin (Question Authority: report facts, and post their links" in your message)
[ Post Reply | Private Reply | To 1947 | View Replies]

To: gleeaikin; AdmSmith; BeauBo

As President of Kazakhstan, Nazarbayev made the same decision Ukraine made, returning the nuclear assets to Russia, and not attempting to acquire nuclear abilities separately. Of course that country is a lot smaller population wise, so probably would have to acquire any nuclear threats by some other means than building their own bomb. Meanwhile, as I read his book I will be interested to see what he may have done to avoid Ukraine’s unfortunate Russia invasion.


1,953 posted on 04/24/2026 11:29:42 AM PDT by gleeaikin (Question Authority: report facts, and post their links" in your message)
[ Post Reply | Private Reply | To 1952 | View Replies]

To: AdmSmith

Israeli defense minister Katz said yesterday, “We are awaiting a green light from the United States — first and foremost to complete the elimination of the Khamenei dynasty...”


1,954 posted on 04/24/2026 3:58:30 PM PDT by nuconvert ( Warning: Accused of being a radical militarist. Approach with caution.)
[ Post Reply | Private Reply | To 1950 | View Replies]

To: AdmSmith

Israeli defense minister Katz said yesterday, “We are awaiting a green light from the United States — first and foremost to complete the elimination of the Khamenei dynasty...”


1,955 posted on 04/24/2026 3:59:10 PM PDT by nuconvert ( Warning: Accused of being a radical militarist. Approach with caution.)
[ Post Reply | Private Reply | To 1950 | View Replies]

To: nuconvert; AdmSmith

“Israeli defense minister Katz said yesterday, “We are awaiting a green light from the United States”

The third Carrier Strike Group is now in the Area of Operations.

Sounds like they are going around getting the thumbs ups, that everyone and everything is ready, before making the launch decision.


1,956 posted on 04/24/2026 9:00:35 PM PDT by BeauBo
[ Post Reply | Private Reply | To 1954 | View Replies]

To: nuconvert; AdmSmith

“Israeli defense minister Katz said yesterday, “We are awaiting a green light from the United States”

The third Carrier Strike Group is now in the Area of Operations.

Sounds like they are going around getting the thumbs ups, that everyone and everything is ready, before making the launch decision.


1,957 posted on 04/24/2026 9:00:35 PM PDT by BeauBo
[ Post Reply | Private Reply | To 1954 | View Replies]

To: nuconvert; gleeaikin; BeauBo; blitz128
Iran Update Special Report, April 24, 2026

Islamic Revolutionary Guards Corps (IRGC) Commander Brigadier General Ahmad Vahidi and his inner circle have repeatedly blocked attempts by Parliament Speaker Mohammad Bagher Ghalibaf and other “pragmatist” officials to push the regime toward a more flexible negotiating position. Vahidi appears to have prevailed in this internal power struggle and will likely shape the regime's approach toward negotiations and the war with a maximalist and uncompromising stance. Ghalibaf likely lacks the leverage to alter this trajectory in a meaningful way at this time. ISW-CTP has observed and reported on a sustained intra-regime rivalry between Vahidi and his inner circle and a “pragmatist” bloc that includes Ghalibaf, President Masoud Pezeshkian, and Foreign Affairs Minister Abbas Araghchi since late March.[1] The rivalry has shown significant divergences between the two blocs over how to approach the war and negotiations. The divergences first surfaced around March 28 when Pezeshkian criticized the IRGC’s actions in the war. Pezeshkian subsequently accused Vahidi and Khatam ol Anbia Central Headquarters Commander IRGC Brigadier General Ali Abdollahi Ali Abadi of “acting unilaterally and fueling escalation.”[2] The United States and Iran agreed to a ceasefire on April 7 after Araghchi reportedly persuaded the IRGC to accept it, which suggests that Vahidi disapproved of the ceasefire and, likely, negotiations. Vahidi and his inner circle then took steps to constrain the authority of Iran's negotiating team, which included Ghalibaf and Araghchi, by attempting to insert Supreme National Security Council (SNSC) Secretary Mohammad Bagher Zolghadr into the delegation and limit its mandate, particularly regarding Iran's missile and nuclear programs.[3] ISW-CTP previously assessed that Vahidi almost certainly attempted to insert Zolghadr into the delegation to ensure that someone from his inner circle could keep tabs on whether Araghchi or Ghalibaf tried to negotiate outside of Vahidi’s red lines.[4] Zolghadr accused Ghalibaf and Araghchi of showing flexibility on certain issues during negotiations in Islamabad on April 11 and 12, after which IRGC leaders called the delegation back to Tehran.[5] The talks collapsed without an agreement, and reports emphasized that the Iranian negotiating team lacked the authority to finalize an agreement.[6] Vahidi continued to reject “pragmatist” efforts to ease tensions with the United States after the first round of negotiations. The IRGC harshly criticized Araghchi after he announced that the Strait of Hormuz was “completely open” on April 17, and the IRGC Navy subsequently attacked several commercial vessels and declared that no vessels of “any type or nationality” were permitted to transit through the strait, for example.[7] Recent US-Iran talks that were expected to take place on April 21 or 22 before the ceasefire expired were canceled due to regime infighting and likely an effort by Vahidi and his camp to derail the talks. Vahidi has consolidated power throughout this rivalry while the “pragmatist” faction has lost influence over regime decision-making.

Vahidi appears to have prevailed over Ghalibaf at this time. Officials from various factions issued coordinated statements on April 23 and 24 that emphasized unity and reaffirmed revolutionary principles.[8] Ghalibaf, Pezeshkian, Araghchi, and Judiciary Chief Gholam Hossein Mohseni Ejei started this messaging, followed by figures aligned with the hardline camp, including Supreme Leader Mojtaba Khamenei, Zolghadr, IRGC Quds Force Commander Brigadier General Esmail Ghaani, and ultra-hardline politician Saeed Jalili.[9] The participation of “pragmatist” figures in this display of unity behind “revolutionary” principles indicates that they have, at least for now, accepted Vahidi’s dominance.

Recent reports that Ghalibaf may resign from being a member of the negotiating team are consistent with ISW-CTP’s assessment that Vahidi has emerged as the winner of the intra-regime rivalry.[10] Sources told Western media that Ghalibaf has grown frustrated with internal divisions and has considered resigning from the negotiating delegation, while some outlets have claimed that Ghalibaf has already resigned from the negotiating team due to disagreements over nuclear concessions.[11] The latter reports are consistent with reports that the Iranian negotiating delegation discussed the nuclear issue “contrary to instructions from Tehran” during the first round of negotiations. Ghalibaf’s resignation, if confirmed, would further signal his defeat and reduce the pragmatists’ influence over negotiations, as well as further consolidate Vahidi’s position within the regime.

“Pragmatist” officials may continue to advocate for a more flexible approach, but their efforts are unlikely to meaningfully shape regime decision-making in the near term. Some senior Iranian officials reportedly signed a secret letter to Mojtaba in recent days, warning that Iran's economic crisis is unsustainable and that serious negotiations with the United States over Iran's nuclear program are unavoidable, according to unspecified individuals familiar with the matter speaking to an Iranian journalist and media executive.[12] The signatories of the letter reportedly included Ghalibaf, Pezeshkian, Araghchi, and Mostafa Pourmohammadi. Pourmohammadi is a hardline politician and cleric from Qom who has served in several positions in the regime.[13] Pourmohammadi implied in May 2025 that he supported US-Iran talks.[14] Repeated failed efforts by this camp to shift policy suggest that the “moderate” or “pragmatist” camp has lost influence over regime decision-making for at least the time being, however.

Vahidi’s apparent victory will likely have significant implications for potential future US-Iran negotiations. His camp supports maximalist demands that are irreconcilable with stated US demands.[15] Vahidi prioritizes ideological consistency and hard power, and he views concessions as incompatible with the principles of the Islamic Revolution. Vahidi’s rejection of certain concessions and control over the scope of talks reflects this view. Iran will likely adopt positions that do not align with stated US demands if Vahidi continues to dominate decision-making.

Vahidi has also shown greater willingness than “pragmatist” officials to accept the risk of renewed conflict with the United States. ISW-CTP previously assessed that the IRGC’s actions in the Strait of Hormuz suggest that Vahidi and individuals close to him have accepted the risk of incurring a potential US military response in order to assert Iranian “control” over the strait.[16] IRGC-affiliated media has also recently signaled readiness for renewed hostilities, and Iranian military preparations have reportedly intensified.[17] Senior officials have also warned of a high likelihood of renewed conflict.[18] The ostentatious Farsi-language show of regime unity behind “revolutionary principles” is likely part of an effort to prepare the Iranian people for a return to war under an ostensibly unified government, as ISW-CTP has previously assessed.[19]

Iran and the United States are both sending delegations to meet with Pakistani mediators in Islamabad this weekend, but it remains unclear whether the delegations will engage in a second round of negotiations at the time of this writing.[20] Iranian Foreign Affairs Minister Abbas Araghchi arrived in Islamabad on April 24 for talks with Pakistani mediators.[21] Araghchi stated that the purpose of his trip is to “discuss bilateral relations and regional cooperation.”[22] IRGC-affiliated media, as well as Pakistani sources and an unspecified Iranian source speaking to Western media, emphasized that Araghchi will not negotiate with US officials while in Islamabad.[23] Ghalibaf is notably not part of the Iranian delegation despite leading the Iranian delegation during the first round of negotiations in Islamabad on April 11 and 12.[24] Araghchi stated that he will travel to Oman, which has historically mediated between Iran and the United States, and Russia after his visit to Islamabad.[25] Araghchi’s planned trip to Russia comes as the Iranian regime is preparing for a potential resumption of conflict (see above).[26] The White House confirmed on April 24 that US Special Envoy to the Middle East Steve Witkoff and Jared Kushner will travel to Islamabad on April 25.[27] White House Press Secretary Karoline Leavitt stated that “the Iranians want to talk” and “they want to talk in person, and the president is always willing to give diplomacy a chance.”[28] Leavitt added that “we have certainly seen some progress from the Iranian side in the last few days.”[29] Pakistani sources told Western media on April 24 that a US technical and logistics team is in Islamabad, while a Pakistani official told Axios that the possibility of a trilateral meeting involving Iran, the United States, and Pakistan would be assessed after Araghchi meets with Pakistani officials.[30] Two other unspecified sources told Axios that a meeting between Araghchi, Witkoff, and Kushner could take place on April 27 following separate bilateral discussions between Witkoff, Kushner, and Pakistani mediators.[31]

Likely Iranian-backed Iraqi militias conducted two fiber-optic drone attacks on Kuwaiti border posts on April 24.[32] The Kuwaiti Army reported that unspecified actors launched two fiber-optic drones from Iraq that hit two Kuwaiti border posts, causing material damage but no casualties.[33] Iraqi Interior Minister Abdul Amir Shammari condemned the attacks in a call with Kuwaiti Interior Minister Fahad Yousef Saud al Sabah.[34] Shammari stated that the Iraqi government will form a specialized committee to investigate the attacks and identify and arrest the perpetrators.[35] Iranian-backed Iraqi militias have not claimed these attacks at the time of this writing. Iranian-backed Iraqi militias have demonstrated their ability to use fiber-optic first-person view (FPV) drones during the war, however.[36] FPV drones can be used for intelligence, surveillance, and reconnaissance, or outfitted with strike capabilities to conduct precise targeting.[37] Open-source intelligence (OSINT) analysts have assessed that drone footage posted by Iraqi militias during the war appeared to be from fiber-optic FPV drones, which are immune to jamming.[38] ISW-CTP previously assessed that Russia is the most likely actor to have provided Iran with fiber-optic drone capabilities, which Iran likely shared with Axis of Resistance groups, including Iranian-backed Iraqi militias.[39] Russia and Ukraine have extensively used FPV drones in their war.[40]

These attacks come after three Iraqi militia members and two unspecified officials told Western media on April 21 that Iranian-backed Iraqi militia “hardline factions” are operating under a decentralized command structure with Iranian advisers.[41] ISW-CTP assessed that these ”hardline” factions could refer to Iranian-backed Iraqi militias Kataib Hezbollah and Harakat Hezbollah al Nujaba, both of which are relatively more subordinate to Iran than other militias.[42]

The US naval blockade appears to be constraining Iran's oil storage capacity. Tanker Trackers reported on April 23 that Iran has recommissioned the retired very large crude carrier (VLCC) Nasha into service, likely to expand Iran's floating storage capacity near Kharg Island in the Persian Gulf as Iran's onshore storage capacity decreases.[43] An Iranian parliamentarian warned on April 24 that Iran continues to produce and store oil on Kharg Island but may have to shut in oil wells if Iran's storage capacity runs out.[44] He noted that restarting production would require billions of dollars.[45] These developments indicate that the blockade is not only limiting Iran's oil exports but also creating downstream pressure on Iran's production system by reducing Iran‘s available storage capacity. Iran's Petroleum Products Exporters Union Spokesperson, Hamid Hosseini, told Iranian media on April 16 that the US naval blockade makes a reduction in oil production “inevitable.”[46] Hosseini added that alternative export routes, such as pipelines, can only handle limited volumes and cannot replace the Strait of Hormuz.[47] Shutting in oil wells risks permanent damage to the wells because the wells may not be able to return to previous output levels.[48]

An unspecified US official and a source with knowledge of the issue told Axios on April 24 that the IRGC Navy laid additional naval mines in the Strait of Hormuz this week.[51] If this report is true, the IRGC’s decision to lay additional mines in the strait would be consistent with the IRGC’s effort to try to assert its “control” over the strait. Axios added that this marks the second time that Iran has mined the strait since the war began and noted that it remains unclear whether all of the previously laid mines have been found and cleared.[52] US officials estimated that the United States has destroyed more than 90 percent of Iran's large mine-laying vessels and mine storage sites but assessed that Iran still retains mine stockpiles along its coast.[53]

Hezbollah claimed that it targeted an Israeli community in northern Israel for the first time since the ceasefire went into effect on April 16.[56] Hezbollah claimed that it fired rockets targeting the northern Israeli border community of Shtula on April 23.[57] The attack coincided with a US-brokered meeting between Israeli and Lebanese officials in Washington, DC, on April 23.[58] The Israel Defense Forces (IDF) reported that Hezbollah fired a small barrage of three or four rockets targeting Shtula and that the Israeli Air Force (IAF) intercepted the rockets.[59] Hezbollah also claimed that it has conducted four attacks, including two first-person view (FPV) drone attacks, targeting Israeli forces in southern Lebanon since ISW-CTP’s last data cutoff on April 23.[60] Israeli media characterized IDF and Hezbollah operations during the ceasefire as a “low-intensity conflict” on April 23.[61] Hezbollah parliamentarian Ali Fayyad called the ceasefire “meaningless” on April 24 because it allows the IDF to respond to imminent Hezbollah threats. Fayyad claimed that Israeli military activity gives Hezbollah “the right to a proportionate response.”[62]

https://understandingwar.org/research/middle-east/iran-update-special-report-april-24-2026/

1,958 posted on 04/25/2026 1:17:51 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 1946 | View Replies]

Iran Update Special Report, April 25 2026

Prospects for meaningful US-Iran negotiations remain low as Islamic Revolutionary Guards Corps (IRGC) Commander Major General Ahmad Vahidi and his inner circle continue to dominate Iran's decision-making and oppose compromise. Iranian Foreign Affairs Minister Abbas Araghchi met with senior Pakistani officials in Islamabad, Pakistan, on April 25 to convey Iran's “observations” on ending the war.[1] Araghchi departed Pakistan after his meetings and arrived in Oman on April 25, according to Iranian media.[2] Iranian Foreign Affairs Ministry Spokesperson Esmail Baghaei stated that no meeting between the United States and Iran was scheduled and that Iran would convey its positions to the United States through Pakistan.[3] A Pakistani journalist, citing unspecified sources, reported on April 25 that Iran will not meet the US delegation and that Iran remains unwilling to engage directly and continues to insist that the United States end its blockade as a precondition for negotiations.[4] This pattern reflects a consistent IRGC-driven negotiating line that includes no flexibility, insistence on maximalist demands, and the use of preconditions to delay or constrain talks.[5] Iranian media reinforced this approach by framing Araghchi’s regional tour as part of a broader strategy to prioritize engagement with mediators and strategic partners, such as Pakistan, Oman, and Russia, rather than an effort at direct negotiations with the United States.[6]

ISW-CTP assessed that in recent days, the IRGC has sidelined civilian officials and that Iran's negotiating team lacks the authority to make independent decisions, which helps explain continued inflexibility and the absence of tangible progress.[7] The Wall Street Journal similarly reported on April 24 that internal regime infighting, driven in part by figures such as Vahidi and other anti-compromise officials, has made compromise difficult.[8] The report noted that Iranian officials became vague when pressed for specifics during earlier talks in Islamabad, which indicates the lack of a clear and unified negotiating position.[9] The IRGC’s consolidation of control over Iranian decision-making indicates that the Iranian political officials do not have the authority to independently determine Iran's negotiating position.[10]

US President Donald Trump canceled US Special Envoy to the Middle East Steve Witkoff and Jared Kushner’s planned trip to Islamabad, Pakistan, for talks with Iran, due to Iran's unchanged negotiating positions.[11] Trump posted on social media on April 25 that he canceled Witkoff and Kushner’s trip to Pakistan because the 18-hour flight would waste time and be “too much work” if the Iranians failed to change their negotiating positions.[12] Trump also said that no one knows who is in charge in Iran, including the Iranians, which has resulted in ”tremendous infighting and confusion.”[13] Trump told Fox News and Axios on April 25 that it did not make sense for him to send Witkoff and Kushner to Pakistan “to sit around talking about nothing.”[14] Trump also told Axios that he canceled Witkoff and Kushner’s trip due to Iran's position on negotiations.[15] Iran appears to be continuing to make maximalist demands (see above). Trump told Axios that his decision not to send Witkoff and Kushner does not mean that he will resume the war with Iran, however.[16] Trump said that if the Iranian leadership wants to talk, then ”all they have to do is call.”[17]

Iran is facing escalating economic pressure that will likely worsen its already severe economic crisis. The US Treasury Department sanctioned Chinese company Hengli Petrochemical Refinery Co., one of Iran's largest crude oil customers, on April 24.[20] The Treasury also targeted 40 shipping firms and vessels involved in transporting illicit Iranian oil.[21] The United States recently froze $344 million USD in cryptocurrency linked to Iran and associated with “unlawful conduct.”[22] These steps to further constrain Iran's economy come amid an ongoing US naval blockade that restricts Iranian exports, including oil, which is a critical source of revenue for the regime.[23]

Hezbollah has continued to use first-person view (FPV) drones in its attacks targeting IDF vehicles in southern Lebanon since the ceasefire took effect on April 16. Hezbollah claimed that it conducted two separate FPV drone attacks targeting IDF vehicles in southern Lebanon on April 22 and 23.[30] Hezbollah also published footage on April 24 that shows two separate FPV drone attacks targeting IDF vehicles on April 13 and April 15.[31] Israeli media noted that Hezbollah has increasingly used FPV drones in its attacks against Israeli forces in recent weeks.[32]

https://understandingwar.org/research/middle-east/iran-update-special-report-april-25-2026/

1,959 posted on 04/26/2026 1:04:31 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 1958 | View Replies]

To: nuconvert
The Islamic Republic has released a mural of Iranian leaders killed thus far. Among them is Mojtaba Khamenei.

https://x.com/UkraineDiary/status/2048311671098147071

1,960 posted on 04/26/2026 1:15:14 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 1959 | View Replies]


Navigation: use the links below to view more comments.
first previous 1-20 ... 1,921-1,9401,941-1,9601,961-1,980 ... 2,381-2,394 next last

Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.

Free Republic
Browse · Search
General/Chat
Topics · Post Article

FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson