a) this *was* a bioweapon
b) It was created or released in China (even if stolen from Canada, or North Carolina, or engineered by Harvard)
...then maybe it would be time for President Trump to do some for-real collusion with Russia, by NUKING Peking (oops, "Beijing") for releasing this biowweapon into the world.
Full disclosure: if it was a bioweapon, and the Harvard Chem. Dept. Head or any of his Chicom stooges had anything to do with it, nuke Harvard too.
I think the Diamond Princess was targeted just so nuking China was off the table. Lol.
not ready to buy the bioweapon theory
trigger warning: do not read the linked article if you’re an anti-vaxxer and don’t flame me, I’m only pointing to data, not the article:
that said - scroll all the way down past the article and most comments to the Feb 7 post by Extended Vacation, to get to his sequencing comparison between Wuhan, Bat and Sars. In short: SARS: YLNTY Virus: LFQNY Bat isolate: LLYDH
Why he feels this is a nature-derived virus:
“There is an alignment with pShutttle-SN for both the circulating virus and the bat faeces virus but it is almost entirely within the S spike region. Furthermore, the S spike in pShuttle-SN is truncated and there is a SARS S spike which is a much better match for both. So the vast majority of the pShuttle-SN match is explained by a natural common ancestor with the SARS S spike. There is a very small section which matches prior to the S spike (somewhere around 21517). I did another search for this “AGAGTTGTTATTTCTAGTGATGTTCTTGTTAACA” and I think it’s part of Replicase 1B — another natural match.
I then took a look at the receptor binding domain which according to the paper “Isolation and characterization of a bat SARS-like coronavirus that uses the ACE2 receptor” has five “key amino acids residues involved in interacting with human ACE2 molecule”. I guessed that if you wanted to engineer the virus to be more SARS like you’d want to change these to be identical to the ones in SARS. The SARS five are YLNTY. The circulating virus has LFQNY and the bat isolate has LLYDH. I’m not sure if the framing is right in my analysis here but nothing looks suspicious to me.
I also googled “CTCCTCGGCGGG” which is a small insert difference and found a short article by Bill Gallaher which indicates this doesn’t look engineered either.
I’n my earlier posts I had misremembered the meta-data of the bat isolate. It’s the same one collected in 2013 that other people are reporting, not from 2014 as I wrote previously.
Notes are below if you want to check them. You will need to copy and paste into a monospace font to get the VVVs to point to the five key amino acids.”
https://respectfulinsolence.com/2020/01/31/2019-ncov-wuhan-outbreakdue-to-failed-coronavirus-vaccine/