Free Republic
Browse · Search
General/Chat
Topics · Post Article


1 posted on 03/09/2019 6:04:55 AM PST by vannrox
[ Post Reply | Private Reply | View Replies ]


Navigation: use the links below to view more comments.
first previous 1-2021-34 last
To: vannrox

Norman Dean was issued a patent for an inertial space drive in 1959.

There is no requirement that a patent actually work.

https://www.jerrypournelle.com/science/dean.html


37 posted on 03/09/2019 7:19:32 AM PST by jdege
[ Post Reply | Private Reply | To 1 | View Replies ]

To: vannrox

I have issues with these inventions.
First, PZT is not a metal and not capable of conducting; it is a piezoelectric ceramic dielectric. It needs a metallic coating to work. Second, if you do plate it with a metal to make a piezoelectric transducer, it has a high capacitance and will need lots of power.

“it appears the Navy relied on an affidavit from an expert, which the Examiner initially argued wasn’t sufficient ...”

How about the opinion of another expert in the field (me).
My credentials: https://www.amazon.com/Ultrasound-Piezoelectric-Physics-Engineers-Applications/dp/1793995389/ref=tmm_pap_swatch_0?_encoding=UTF8&qid=1552143786&sr=8-3

These inventions are flim-flam and won’t work.


39 posted on 03/09/2019 7:21:09 AM PST by BuffaloJack (Chivalry is not dead. It is a warriors code and only practiced by warriors.)
[ Post Reply | Private Reply | To 1 | View Replies ]

To: vannrox

Die Glocke


44 posted on 03/09/2019 7:35:53 AM PST by R0CK3T
[ Post Reply | Private Reply | To 1 | View Replies ]

To: vannrox

Was this made by Andrea Rossi?!
Where’s Kevmo?


47 posted on 03/09/2019 7:38:33 AM PST by EEGator
[ Post Reply | Private Reply | To 1 | View Replies ]

To: vannrox

Since 1952, the US has had on the books the Invention Secrecy Act that permits the federal government to keep a patent secret, even ones developed independently of government labs. As of 2017, there are almost six thousand such secret patents. With such a system of secrecy in place, I am hard put to imagine why these patents, if they represent genuine and practical innovations, would be applied for by the US Navy and permitted to become public.


48 posted on 03/09/2019 7:40:54 AM PST by Rockingham
[ Post Reply | Private Reply | To 1 | View Replies ]

To: vannrox

I don’t understand any of it even with pictures, but I’m bookmarking it for possible future epiphany.


54 posted on 03/09/2019 7:58:12 AM PST by PLMerite ("They say that we were Cold Warriors. Yes, and a bloody good show, too." - Robert Conquest)
[ Post Reply | Private Reply | To 1 | View Replies ]

To: vannrox

Captain Honor Harrington: To the bridge!


64 posted on 03/09/2019 9:58:39 AM PST by Don W (When blacks riot, neighbourhoods and cities burn. When whites riot, nations and continents burn.)
[ Post Reply | Private Reply | To 1 | View Replies ]

To: vannrox

propagating gravitational field fluctuations are generated when the second electromagnetic field propagates through the first electromagnetic field.


Not buying it.


66 posted on 03/09/2019 10:21:15 AM PST by sparklite2 (Don't mind me. I'm just a contrarian.)
[ Post Reply | Private Reply | To 1 | View Replies ]

To: vannrox
He's just patenting what's already here
Zero Point - Classified Anti Gravity Craft
with scale drawings and explanations.

All of this can be found in James Clerk Maxwell's original 200 field equations before they were butchered by Oliver Heaviside into only four vector equations.

Tesla used the original equations as best he could understand them to construct his devices and discover AC electricity.

68 posted on 03/09/2019 11:13:45 AM PST by PIF (They came for me and mine ... now it is your turn ...)
[ Post Reply | Private Reply | To 1 | View Replies ]

BFL


72 posted on 03/09/2019 11:47:23 AM PST by Darth Mall
[ Post Reply | Private Reply | To 1 | View Replies ]

To: vannrox
Gravitational Wave Generator

THATS HEAVY.

73 posted on 03/09/2019 12:47:14 PM PST by Delta 21
[ Post Reply | Private Reply | To 1 | View Replies ]

To: vannrox

I read about at least two of these about 12 years ago in an odd physics magazine I got at a local Barnes and Noble.


76 posted on 03/09/2019 1:08:16 PM PST by ConservativeMind (Trump: Befuddling Democrats, Republicans, and the Media for the benefit of the US and all mankind.)
[ Post Reply | Private Reply | To 1 | View Replies ]

To: vannrox; SunkenCiv

No problem, they will not work.


82 posted on 03/09/2019 2:12:56 PM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 1 | View Replies ]

To: vannrox; SunkenCiv

The thing doesn’t have to work in order to get a patent........................


87 posted on 03/11/2019 6:24:59 AM PDT by Red Badger (We are headed for a Civil War. It won't be nice like the last one....................)
[ Post Reply | Private Reply | To 1 | View Replies ]


Navigation: use the links below to view more comments.
first previous 1-2021-34 last

Free Republic
Browse · Search
General/Chat
Topics · Post Article


FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson