Free Republic
Browse · Search
General/Chat
Topics · Post Article

Individuals become infected when swimming in warm freshwater, such as a lake or river. The amoeba enters the nose and then goes to the brain, where it destroys brain tissue, causing swelling and death. Symptoms begin between one and nine days after exposure and include headache, fever, nausea and vomiting.

It can be confused with meningitis at first. Then a stiff neck, seizures and hallucinations begin as the infection becomes worse. Those infected die between one and 18 days after symptoms begin

1 posted on 08/18/2016 11:54:23 AM PDT by Tilted Irish Kilt
[ Post Reply | Private Reply | View Replies ]


To: Tilted Irish Kilt
OK,folks...let's sing along:

WHEN IT'S FIESTA TIME,IN GUADALAJARA....


2 posted on 08/18/2016 11:57:20 AM PDT by Gay State Conservative (The Rat Party,try as it might,just isn't very good at hiding what it *truly* is.)
[ Post Reply | Private Reply | To 1 | View Replies ]

To: Tilted Irish Kilt
Makes Wrath of Khan seem positively pleasant by comparison.


3 posted on 08/18/2016 11:57:23 AM PDT by Buckeye McFrog
[ Post Reply | Private Reply | To 1 | View Replies ]

To: Tilted Irish Kilt
Fourth brain-eating amoeba case of the year being treated ( Florida )

Ah, so this explains how Hillary's polling has been improving in Florida.

4 posted on 08/18/2016 11:57:57 AM PDT by pepsi_junkie (ui)
[ Post Reply | Private Reply | To 1 | View Replies ]

To: 2ndreconmarine; Fitzcarraldo; Covenantor; Mother Abigail; EBH; Dog Gone; ...
INFECTIOUS DISEASE PING

Fourth brain-eating amoeba case of the year being treated

Amoeba infected when swimming in warm freshwater, such as a lake or river ; symptoms included in the article

5 posted on 08/18/2016 11:58:02 AM PDT by Tilted Irish Kilt ( British historian Arnold Toynbee - Civilisations die from suicide, not by murder.)
[ Post Reply | Private Reply | To 1 | View Replies ]

To: Tilted Irish Kilt
Could not help but think of this long ago episode of Night Gallery. In reality, the brain has no nerves of its own so pain would not necessarily be an issue. But other than that it's an awful diagnosis.


8 posted on 08/18/2016 12:14:12 PM PDT by katana
[ Post Reply | Private Reply | To 1 | View Replies ]

To: Tilted Irish Kilt

Good review article

Free-Living Amoebae as Hosts for and Vectors of Intracellular Microorganisms with Public Health Significance
Carsten Balczun and Patrick L. Scheid

Free-living amoebae (FLA) are parasites within both humans and animals causing a wide range of symptoms and act as hosts of, and vehicles for phylogenetically diverse microorganisms, called endocytobionts. The interaction of the FLA with sympatric microorganisms leads to an exceptional diversity within FLA. Some of these bacteria, viruses, and even eukaryotes, can live and replicate intracellularly within the FLA. This relationship provides protection to the microorganisms from external interventions and a dispersal mechanism across various habitats. Among those intracellularly-replicating or -residing organisms there are obligate and facultative pathogenic microorganisms affecting the health of humans or animals and are therefore of interest to Public Health Authorities. Mimiviruses, Pandoraviruses, and Pithoviruses are examples for interesting viral endocytobionts within FLA. Future research is expected to reveal further endocytobionts within free-living amoebae and other protozoa through co-cultivation studies, genomic, transcriptomic, and proteomic analyses.

https://www.ncbi.nlm.nih.gov/pmc/articles/PMC5408671/

table
Selection of microorganisms interacting with free-living amoebae (FLA), including pathogens with public health importance.
https://www.ncbi.nlm.nih.gov/pmc/articles/PMC5408671/table/viruses-09-00065-t001/


11 posted on 07/16/2017 12:28:51 PM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 1 | View Replies ]

Free Republic
Browse · Search
General/Chat
Topics · Post Article


FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson